ID: 1160725544

View in Genome Browser
Species Human (GRCh38)
Location 19:616464-616486
Sequence GGTCGGCGAGGGTCACAAGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 2, 2: 0, 3: 1, 4: 53}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160725544_1160725559 3 Left 1160725544 19:616464-616486 CCAACTTGTGACCCTCGCCGACC 0: 1
1: 2
2: 0
3: 1
4: 53
Right 1160725559 19:616490-616512 CCGCGGGCCCAGGCGGGCCGGGG 0: 1
1: 0
2: 5
3: 47
4: 421
1160725544_1160725549 -7 Left 1160725544 19:616464-616486 CCAACTTGTGACCCTCGCCGACC 0: 1
1: 2
2: 0
3: 1
4: 53
Right 1160725549 19:616480-616502 GCCGACCGCCCCGCGGGCCCAGG 0: 1
1: 0
2: 5
3: 36
4: 260
1160725544_1160725555 1 Left 1160725544 19:616464-616486 CCAACTTGTGACCCTCGCCGACC 0: 1
1: 2
2: 0
3: 1
4: 53
Right 1160725555 19:616488-616510 CCCCGCGGGCCCAGGCGGGCCGG 0: 1
1: 0
2: 5
3: 40
4: 358
1160725544_1160725551 -4 Left 1160725544 19:616464-616486 CCAACTTGTGACCCTCGCCGACC 0: 1
1: 2
2: 0
3: 1
4: 53
Right 1160725551 19:616483-616505 GACCGCCCCGCGGGCCCAGGCGG 0: 1
1: 0
2: 2
3: 13
4: 161
1160725544_1160725552 -3 Left 1160725544 19:616464-616486 CCAACTTGTGACCCTCGCCGACC 0: 1
1: 2
2: 0
3: 1
4: 53
Right 1160725552 19:616484-616506 ACCGCCCCGCGGGCCCAGGCGGG 0: 1
1: 0
2: 2
3: 17
4: 215
1160725544_1160725562 8 Left 1160725544 19:616464-616486 CCAACTTGTGACCCTCGCCGACC 0: 1
1: 2
2: 0
3: 1
4: 53
Right 1160725562 19:616495-616517 GGCCCAGGCGGGCCGGGGGCGGG 0: 1
1: 1
2: 17
3: 160
4: 1191
1160725544_1160725557 2 Left 1160725544 19:616464-616486 CCAACTTGTGACCCTCGCCGACC 0: 1
1: 2
2: 0
3: 1
4: 53
Right 1160725557 19:616489-616511 CCCGCGGGCCCAGGCGGGCCGGG 0: 1
1: 0
2: 4
3: 40
4: 508
1160725544_1160725560 4 Left 1160725544 19:616464-616486 CCAACTTGTGACCCTCGCCGACC 0: 1
1: 2
2: 0
3: 1
4: 53
Right 1160725560 19:616491-616513 CGCGGGCCCAGGCGGGCCGGGGG 0: 1
1: 0
2: 3
3: 61
4: 414
1160725544_1160725561 7 Left 1160725544 19:616464-616486 CCAACTTGTGACCCTCGCCGACC 0: 1
1: 2
2: 0
3: 1
4: 53
Right 1160725561 19:616494-616516 GGGCCCAGGCGGGCCGGGGGCGG 0: 1
1: 1
2: 24
3: 143
4: 1215
1160725544_1160725563 9 Left 1160725544 19:616464-616486 CCAACTTGTGACCCTCGCCGACC 0: 1
1: 2
2: 0
3: 1
4: 53
Right 1160725563 19:616496-616518 GCCCAGGCGGGCCGGGGGCGGGG 0: 1
1: 2
2: 19
3: 123
4: 988

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160725544 Original CRISPR GGTCGGCGAGGGTCACAAGT TGG (reversed) Exonic
902665066 1:17931632-17931654 GCTCGGCCAAGGTCACATGTGGG - Intergenic
906264228 1:44416751-44416773 GGTCGGGCAGAGTCACAGGTAGG + Intronic
913221756 1:116666146-116666168 GGTCGGTGTGTGTCACAGGTTGG - Intronic
924583480 1:245341799-245341821 GGGCAGGGAGGGTCACCAGTTGG + Intronic
1073447433 10:103589940-103589962 GGTTGGAGTGGGTCAGAAGTGGG + Intronic
1081613606 11:44577969-44577991 GCCCAGGGAGGGTCACAAGTTGG - Intronic
1088564299 11:111151673-111151695 TGTTAGCGAGGGTCACATGTGGG + Intergenic
1091460994 12:643236-643258 GGTCGCTGAGGGTCACAGGAGGG - Intronic
1101782258 12:107846357-107846379 GGGCAGGGTGGGTCACAAGTAGG + Intergenic
1113940120 13:114014631-114014653 GGTCGGCAAGGTTGAGAAGTGGG + Intronic
1119319335 14:73720151-73720173 GGTGGTCGAGGCTCAGAAGTGGG + Intronic
1124500884 15:30225554-30225576 GGTTGGCGAGGGTCACAAGTTGG - Intergenic
1124742686 15:32313113-32313135 GGTTGGCGAGGGTCACAAGTTGG + Intergenic
1129251089 15:74309319-74309341 GGTGGGCGAGGGGTACAAGGTGG - Intronic
1129856196 15:78827033-78827055 GGTGAGAGAGGGTCACAATTTGG - Intronic
1132482499 16:173486-173508 GGGCGGCCAGGGTCACCAGCAGG - Exonic
1132483352 16:177297-177319 GGGCGGCCAGGGTCACCAGCAGG - Exonic
1132550073 16:550667-550689 GGTCGGTGAGGGCCCCCAGTCGG + Intronic
1132550086 16:550700-550722 GGTCGGTGAGGGTCCCCTGTCGG + Intronic
1132550148 16:550863-550885 GGTCGGTGAGGGTCCCCTGTCGG + Intronic
1132550182 16:550962-550984 GGTCGGTGAGGGTCCCCTGTTGG + Intronic
1132550194 16:550995-551017 GGTCGGTGAGGGTCCCCTGTCGG + Intronic
1132550215 16:551044-551066 GGTCGGTGAGGGTCCCCGGTCGG + Intronic
1132550235 16:551093-551115 GGTCGGTGAGGGTCCCCGGTCGG + Intronic
1132550273 16:551191-551213 GGTCGGTGAGGGTCCCCAGTCGG + Intronic
1132550291 16:551241-551263 GGTCGGTGAGGGTCCCCTGTCGG + Intronic
1132577478 16:670630-670652 GGTCGGCGTGGGTCACCTGAGGG + Intronic
1136153610 16:28367961-28367983 AGTTGGTGAGGGACACAAGTTGG - Intergenic
1136209477 16:28747306-28747328 AGTTGGTGAGGGACACAAGTTGG + Intergenic
1137039558 16:35598034-35598056 GGTCGGTGAAGGCCACAAGAAGG - Intergenic
1140124687 16:72109375-72109397 GGGAGGCGAGGGTCACAGGAGGG - Intronic
1142608211 17:1093945-1093967 GCGCGGCGAGGGTCAGAAGGAGG - Intronic
1142608235 17:1094059-1094081 GGACGGTGAGGGTCAGAAGGAGG - Intronic
1152336382 17:79701749-79701771 GGAGGGCGAGGGGCACAGGTAGG + Intergenic
1152782336 17:82231857-82231879 GGTCTGCGGGGGTCAGAGGTGGG + Intronic
1158648118 18:59265201-59265223 GGTCGCTGAAGGTCAGAAGTTGG + Intergenic
1160725544 19:616464-616486 GGTCGGCGAGGGTCACAAGTTGG - Exonic
1160946403 19:1645923-1645945 AGTCGTCGAGGCTCACAAGGTGG + Intronic
1161003066 19:1920859-1920881 GGTCTCTGAGGGTCACATGTGGG - Intronic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1162643756 19:12033940-12033962 GGTAGGCCAGGGTCACAGGGTGG + Intronic
930024041 2:47019548-47019570 GGTCAGAGTGGATCACAAGTTGG + Intronic
1169906944 20:10614059-10614081 GGTGGGCGAGGGCGACAAGGAGG - Intronic
1170760036 20:19240989-19241011 GGCCAGCCAGGTTCACAAGTGGG - Intronic
1175931714 20:62496651-62496673 GGTCTGCGAGGGTCTCCAGGAGG + Intergenic
1183255328 22:36758092-36758114 GGAGGGCCAGGGTCCCAAGTGGG + Intergenic
1183282984 22:36942773-36942795 GGTTGGGGAGGGCCCCAAGTGGG - Intergenic
951400325 3:22225376-22225398 GGTGGGCTCGGGTTACAAGTGGG - Intronic
988099085 5:26655506-26655528 GGTCGGAGAAGGTCACAGGAGGG + Intergenic
1007394468 6:41569749-41569771 GGTCAGCGAGGGTCACGGGAGGG + Intronic
1024225699 7:47325264-47325286 GGAGGACGAGGGTCACCAGTGGG - Intronic
1033850509 7:145488825-145488847 GCCCAGCAAGGGTCACAAGTTGG + Intergenic
1057487838 9:95499897-95499919 GGTAGGGGAGAGTCACAATTGGG - Intronic
1061092465 9:128434290-128434312 GGCCGGCCAGGGTCCCAAGCAGG - Intronic
1187485507 X:19699440-19699462 GGTCGTAGAGGGACACAGGTGGG - Intronic
1192173990 X:68874559-68874581 GGTAGGCCAGGGTCACAGGAGGG + Intergenic
1197716757 X:129714605-129714627 GGTAGTCAAGGGTCACGAGTGGG + Intergenic