ID: 1160725808

View in Genome Browser
Species Human (GRCh38)
Location 19:617367-617389
Sequence GCTCGAACTGCGGGCCAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 107}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160725808_1160725820 16 Left 1160725808 19:617367-617389 CCGCCCTGGCCCGCAGTTCGAGC 0: 1
1: 0
2: 0
3: 4
4: 107
Right 1160725820 19:617406-617428 CCCACCCGCCTACCTGGCTTGGG 0: 1
1: 0
2: 0
3: 8
4: 164
1160725808_1160725817 10 Left 1160725808 19:617367-617389 CCGCCCTGGCCCGCAGTTCGAGC 0: 1
1: 0
2: 0
3: 4
4: 107
Right 1160725817 19:617400-617422 AGGCTGCCCACCCGCCTACCTGG 0: 1
1: 0
2: 2
3: 18
4: 140
1160725808_1160725813 -10 Left 1160725808 19:617367-617389 CCGCCCTGGCCCGCAGTTCGAGC 0: 1
1: 0
2: 0
3: 4
4: 107
Right 1160725813 19:617380-617402 CAGTTCGAGCCACCCTTGCGAGG 0: 1
1: 0
2: 1
3: 0
4: 39
1160725808_1160725818 15 Left 1160725808 19:617367-617389 CCGCCCTGGCCCGCAGTTCGAGC 0: 1
1: 0
2: 0
3: 4
4: 107
Right 1160725818 19:617405-617427 GCCCACCCGCCTACCTGGCTTGG 0: 1
1: 0
2: 1
3: 14
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160725808 Original CRISPR GCTCGAACTGCGGGCCAGGG CGG (reversed) Intronic
900076594 1:822424-822446 GGTGGATCTGCTGGCCAGGGAGG - Intergenic
900374613 1:2347697-2347719 GTTCTGACTGCGGGACAGGGAGG + Intronic
901017892 1:6242251-6242273 TCTCGAGCTGCGGGGCAGCGGGG - Intergenic
901691165 1:10974128-10974150 GCCCCACCTGTGGGCCAGGGAGG + Intronic
903023398 1:20410275-20410297 GCTGGAACTGTGGACCAGGGAGG - Intergenic
906132444 1:43468748-43468770 GCCCGACCTTCAGGCCAGGGAGG - Intergenic
911540015 1:99146685-99146707 GCTCCACCTTCAGGCCAGGGAGG + Intergenic
916589006 1:166172222-166172244 GCTTGACCTGAGGCCCAGGGTGG - Intergenic
918097263 1:181345716-181345738 GCACAAACTGCGGCCCAGGAAGG + Intergenic
922162480 1:223088766-223088788 GCTAGAAGTGCGGGCAAAGGAGG - Intergenic
922302361 1:224312789-224312811 TCTCGTACTGTGGGCCAGGCTGG - Intronic
1065845125 10:29737007-29737029 GCTCGGACCGCGCGCCAGGCCGG + Intergenic
1067405519 10:46019947-46019969 GCTCTAACTGCGCCACAGGGAGG - Intronic
1069557640 10:69408248-69408270 GCTGGAACTGCGGACCCCGGAGG - Intronic
1069635258 10:69921135-69921157 GCTCCATCTGAGGGCCAAGGGGG + Intronic
1071068770 10:81667656-81667678 ACTCGAACTGCAGCCTAGGGTGG + Intergenic
1071957061 10:90770839-90770861 GCCCCACCTTCGGGCCAGGGAGG + Intronic
1076793349 10:132787757-132787779 GCGGGAACTGCGGGGCCGGGGGG + Intergenic
1078538994 11:12198569-12198591 GCTGGTACTGAGAGCCAGGGAGG + Intronic
1082990888 11:59206357-59206379 GAACGAATTGGGGGCCAGGGAGG + Exonic
1083779918 11:64912417-64912439 CCTCCAACTGGGGGCCAAGGAGG + Exonic
1084546416 11:69817268-69817290 GCTCGGACCGCGTGCCAGGAGGG - Intronic
1084970218 11:72767409-72767431 GCTGAAACTGAGGCCCAGGGAGG + Intronic
1093059615 12:14589252-14589274 GCTCCACCTTCAGGCCAGGGAGG - Intergenic
1093281792 12:17204168-17204190 GCTCAACCTTCAGGCCAGGGAGG + Intergenic
1096575245 12:52548748-52548770 GGTGGAACTGCAGGCCAAGGTGG - Exonic
1099955822 12:89352043-89352065 GGTCGAGCTGCGGGAGAGGGCGG + Exonic
1100679776 12:96907055-96907077 GCGGGAACTGCGGGCCGGGGCGG - Intergenic
1102490725 12:113288248-113288270 CCTGGACCTGCAGGCCAGGGTGG - Intronic
1105496443 13:20934882-20934904 TCTCAAACTGTGTGCCAGGGTGG - Intergenic
1114069238 14:19094905-19094927 GGTCCCACTGCGGGCCAGGAGGG + Intergenic
1114093021 14:19305097-19305119 GGTCCCACTGCGGGCCAGGAGGG - Intergenic
1119975623 14:79020605-79020627 GCTGAGACTGCGGGTCAGGGTGG + Intronic
1121358023 14:93231321-93231343 GCTGGCACTGGGGGGCAGGGAGG + Intergenic
1122969114 14:105145284-105145306 GCTCCACCTGCAGGCCAGTGGGG + Intronic
1125770657 15:42163490-42163512 GCCAAAACTGCGGGCCAGGACGG + Intronic
1125873411 15:43123043-43123065 GCTGGAACTGGGTCCCAGGGAGG - Intronic
1129253529 15:74321345-74321367 GCTTGAACTGGGGGGCAGGCGGG - Intronic
1129273861 15:74433198-74433220 GCCCGAGCTCCGGGCCGGGGCGG + Intronic
1133316812 16:4890035-4890057 GCTTGAGCTGAGGCCCAGGGAGG + Intronic
1138279234 16:55760543-55760565 GCGGTAACTGGGGGCCAGGGTGG + Intergenic
1139513189 16:67438861-67438883 GCTTGTACTCCTGGCCAGGGGGG + Exonic
1139626290 16:68191601-68191623 GCACAAAGTACGGGCCAGGGGGG + Exonic
1142303134 16:89270462-89270484 TCTGGAAGTGCTGGCCAGGGCGG - Intronic
1142434342 16:90047390-90047412 GCTGGAACTGAGGGCCTGGGGGG - Intergenic
1142604800 17:1075519-1075541 GCTCGGACTGCGGGTAAGGCTGG - Intronic
1144849501 17:18236922-18236944 GCTGGCACTGCAGGCCAGGTAGG + Exonic
1145936873 17:28719378-28719400 GGTCGAACTGAGGTCCAGAGAGG - Exonic
1146377100 17:32302214-32302236 GCAGGAAGTGTGGGCCAGGGAGG - Intronic
1148567081 17:48639782-48639804 CCTCGAACTGCTGGGCAGGTGGG + Intergenic
1152102331 17:78309356-78309378 GAGAGAACTGAGGGCCAGGGAGG + Intergenic
1152288093 17:79424005-79424027 ACTCGGACTGAGGGGCAGGGAGG - Intronic
1153925079 18:9828248-9828270 GCTCGATGTGCTGGCCAGGATGG + Intronic
1154942901 18:21132486-21132508 GCTCCACCTGCGGCCCAGTGCGG - Intergenic
1157462968 18:47918060-47918082 GCAGGAACTGAGGGCCAGGCAGG + Intronic
1158415670 18:57247833-57247855 ACTCTACCTGCTGGCCAGGGAGG - Intergenic
1160725808 19:617367-617389 GCTCGAACTGCGGGCCAGGGCGG - Intronic
1160989145 19:1853494-1853516 GCCCCACCTGCAGGCCAGGGAGG + Exonic
1161063545 19:2226925-2226947 GCGCGAACTGCGGTCCCGGCGGG - Exonic
1162448154 19:10737165-10737187 GAGGGAACTGAGGGCCAGGGAGG - Intronic
1162511303 19:11120425-11120447 GGTTGATCTGCGGGGCAGGGAGG - Exonic
1163321352 19:16576824-16576846 GCTCGAGCTGCTGCCCAGTGCGG - Exonic
1164922900 19:32102942-32102964 GCTCCCACTGCTGGCCAGGGTGG - Intergenic
1165878492 19:39026342-39026364 CCTGGAGCTGCAGGCCAGGGTGG - Intronic
1166006262 19:39909335-39909357 TCTCGATCTGTGGGCCAGGCTGG + Intronic
1167276619 19:48543843-48543865 GCTGGGACTGGGGGTCAGGGAGG - Intergenic
1168152501 19:54456482-54456504 GCTCGACACACGGGCCAGGGTGG + Intronic
926281063 2:11446947-11446969 ACAAGCACTGCGGGCCAGGGTGG - Intronic
927226162 2:20767641-20767663 GCCCCACCTGCAGGCCAGGGAGG + Intronic
1168757035 20:325309-325331 GCTCGGGCTGCGGGGCTGGGCGG - Intergenic
1172245639 20:33443563-33443585 GCTGGAGCTGCGCGCCGGGGCGG - Exonic
1180099738 21:45578970-45578992 CCAGGAACTGCAGGCCAGGGTGG - Intergenic
1180487711 22:15817468-15817490 GGTCCCACTGCGGGCCAGGAGGG + Intergenic
1180733878 22:18001448-18001470 GCTCGGGCTGCGGAACAGGGCGG - Intronic
1182024430 22:27106893-27106915 GCAAAAACTGCGGGTCAGGGAGG + Intergenic
953932494 3:47012660-47012682 GCTCGAACTGCAGAGCTGGGAGG + Intergenic
956595853 3:70966250-70966272 GAGCTAACTGGGGGCCAGGGGGG + Intronic
957586810 3:82143146-82143168 GCTAGAACTTAGGGCTAGGGAGG - Intergenic
958675592 3:97265228-97265250 GCTCCACCTTCAGGCCAGGGAGG - Intronic
962132209 3:132693265-132693287 GCTGGAACTGCTGGCTATGGGGG + Intronic
969682243 4:8649788-8649810 GCTGGAACTGTGGGGCAGGCGGG - Intergenic
970008091 4:11429121-11429143 GCTGGAGCTGCGTGCCAGGCGGG - Exonic
973590334 4:52434404-52434426 GCTCCAGCTCCAGGCCAGGGAGG - Intergenic
973878185 4:55241867-55241889 GCTCCACCTGCGGCCCAGTGTGG + Intergenic
980180217 4:129392728-129392750 GCTCCACCTTCAGGCCAGGGTGG + Intergenic
980738264 4:136918180-136918202 GCTCCACCTTCAGGCCAGGGTGG + Intergenic
985067294 4:186135007-186135029 GCTGGTACTGCGGCCCAGGATGG - Intronic
986691745 5:10319020-10319042 GCTAGAACTGAAGGTCAGGGTGG - Intergenic
1002679244 5:180948425-180948447 GCTCAAACTGTGGATCAGGGAGG - Intronic
1002685119 5:181003922-181003944 GCTCAAACTGTGGATCAGGGAGG - Intronic
1007704116 6:43780840-43780862 GGTTGTACTGGGGGCCAGGGAGG - Exonic
1013227351 6:108129548-108129570 GCTGGACCAGTGGGCCAGGGTGG + Intronic
1014291931 6:119568693-119568715 GCTCGAACTGGGGTTCAGAGAGG - Intergenic
1019695484 7:2443768-2443790 TCTCAAACTCCAGGCCAGGGTGG + Intergenic
1035533760 8:375557-375579 GGTGGATCTGCTGGCCAGGGAGG + Intergenic
1035533780 8:375662-375684 GGTGGATCTGCTGGCCAGGGAGG + Intergenic
1036632288 8:10524238-10524260 GCTCGAGCTACTGCCCAGGGAGG - Intergenic
1036659445 8:10698482-10698504 GCTGGAGCTGGGGCCCAGGGAGG + Intronic
1049240401 8:141534981-141535003 GCCTGAGCTGCAGGCCAGGGTGG - Intergenic
1052462068 9:28777524-28777546 GCTCAAACTGTGTGCCAGTGAGG + Intergenic
1058379502 9:104362851-104362873 GCTCCACCTGCGGCCCAGTGTGG - Intergenic
1060229101 9:121814007-121814029 GCTCACACTGGGGCCCAGGGAGG - Intergenic
1060945758 9:127568737-127568759 GCGCCAACTGCTGGCCGGGGCGG + Intronic
1061978827 9:134088099-134088121 GCGTGAACTGCAGGCCAGGCTGG - Intergenic
1062360497 9:136185824-136185846 CCTCGGGCAGCGGGCCAGGGAGG - Intergenic
1185888473 X:3803145-3803167 TCTCGAACTCCAGGCCAGGCTGG - Intergenic
1190862626 X:54358638-54358660 GCGCGCACTGCGGTCCTGGGGGG - Intronic
1195126491 X:101813823-101813845 GCTCCACCTTCAGGCCAGGGAGG + Intergenic
1195460207 X:105115699-105115721 GCTCCACCTGCGGCCCAGTGCGG - Intronic
1198803356 X:140469778-140469800 GCTGGAATTGTGGGCCCGGGTGG + Intergenic
1199264698 X:145817489-145817511 GCCCGAGCTGCAGCCCAGGGTGG + Intergenic
1201041334 Y:9835172-9835194 GCTCACACTGTGGGCCAGTGTGG + Intergenic