ID: 1160725808

View in Genome Browser
Species Human (GRCh38)
Location 19:617367-617389
Sequence GCTCGAACTGCGGGCCAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 107}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160725808_1160725813 -10 Left 1160725808 19:617367-617389 CCGCCCTGGCCCGCAGTTCGAGC 0: 1
1: 0
2: 0
3: 4
4: 107
Right 1160725813 19:617380-617402 CAGTTCGAGCCACCCTTGCGAGG 0: 1
1: 0
2: 1
3: 0
4: 39
1160725808_1160725817 10 Left 1160725808 19:617367-617389 CCGCCCTGGCCCGCAGTTCGAGC 0: 1
1: 0
2: 0
3: 4
4: 107
Right 1160725817 19:617400-617422 AGGCTGCCCACCCGCCTACCTGG 0: 1
1: 0
2: 2
3: 18
4: 140
1160725808_1160725818 15 Left 1160725808 19:617367-617389 CCGCCCTGGCCCGCAGTTCGAGC 0: 1
1: 0
2: 0
3: 4
4: 107
Right 1160725818 19:617405-617427 GCCCACCCGCCTACCTGGCTTGG 0: 1
1: 0
2: 1
3: 14
4: 184
1160725808_1160725820 16 Left 1160725808 19:617367-617389 CCGCCCTGGCCCGCAGTTCGAGC 0: 1
1: 0
2: 0
3: 4
4: 107
Right 1160725820 19:617406-617428 CCCACCCGCCTACCTGGCTTGGG 0: 1
1: 0
2: 0
3: 8
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160725808 Original CRISPR GCTCGAACTGCGGGCCAGGG CGG (reversed) Intronic