ID: 1160726482

View in Genome Browser
Species Human (GRCh38)
Location 19:619933-619955
Sequence AGGGTGTGCCCTGCTGCCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 177}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160726482_1160726493 24 Left 1160726482 19:619933-619955 CCCCGGGCAGCAGGGCACACCCT 0: 1
1: 0
2: 1
3: 18
4: 177
Right 1160726493 19:619980-620002 ACGTCCTGCGGCACATCCGAGGG 0: 3
1: 0
2: 0
3: 1
4: 22
1160726482_1160726490 12 Left 1160726482 19:619933-619955 CCCCGGGCAGCAGGGCACACCCT 0: 1
1: 0
2: 1
3: 18
4: 177
Right 1160726490 19:619968-619990 ACGCCGCTGTACACGTCCTGCGG 0: 3
1: 0
2: 0
3: 0
4: 19
1160726482_1160726492 23 Left 1160726482 19:619933-619955 CCCCGGGCAGCAGGGCACACCCT 0: 1
1: 0
2: 1
3: 18
4: 177
Right 1160726492 19:619979-620001 CACGTCCTGCGGCACATCCGAGG 0: 3
1: 0
2: 0
3: 2
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160726482 Original CRISPR AGGGTGTGCCCTGCTGCCCG GGG (reversed) Intronic
900343328 1:2199003-2199025 GGGGTGTGCCTTGGTGCCCTTGG + Intronic
900586196 1:3433400-3433422 AGGCTTGGCCCTGCTGGCCGGGG + Intronic
901338372 1:8471491-8471513 GGGTTTTGCCATGCTGCCCGGGG + Intronic
901633461 1:10658959-10658981 AGGGCGGCCCCTGCTGCCTGGGG - Intronic
902886452 1:19408193-19408215 AGGCTGTGCCCTGATGCCCTGGG - Intronic
903131851 1:21284694-21284716 AGGATGGGGCCTGCTGCCTGGGG + Intronic
903168694 1:21538718-21538740 AGGGTGCGCCCACCTGGCCGGGG + Intronic
903741470 1:25560893-25560915 GGGGTGGGCCCTGCTTCCTGGGG - Intronic
904934777 1:34122454-34122476 AGGGAGGGCCCTGCTGCTTGAGG - Intronic
906073073 1:43031673-43031695 AGGGTGTGTCCTCCTGCACCCGG + Intergenic
908896057 1:68900767-68900789 AAGATGGACCCTGCTGCCCGAGG - Intergenic
910411121 1:86945874-86945896 AGGTTTTGCCATGCTGCCCAGGG - Intronic
914196282 1:145449644-145449666 AGGCTGTGCACTGCGCCCCGTGG - Intergenic
915916318 1:159943071-159943093 GGGCTGTGACCTGCTGCCCCCGG - Exonic
920446146 1:206020356-206020378 AGGCTGTGCCCTGCTGGCCTCGG + Intronic
920770481 1:208880429-208880451 AGGGTTTGCCATACTGCCCTTGG - Intergenic
923765289 1:236887679-236887701 AGGGTCCGCCCTGCTGCCCCAGG + Intronic
1062872222 10:915256-915278 AGGGTCTGCTCTGTTGCCTGGGG - Intronic
1064143078 10:12806531-12806553 GGGGTGAGCCCTGCTGGCCAGGG - Intronic
1066623308 10:37380811-37380833 AGGCTGAGCCCTGCTGCCCCTGG - Intronic
1067790627 10:49284694-49284716 AGGGTGTGCTCTGTCACCCGTGG - Intergenic
1068960724 10:62863982-62864004 ACTGTGAGCCCTGCTGACCGTGG - Intronic
1070662792 10:78319656-78319678 AGGCTTTGCACTGCTTCCCGTGG - Intergenic
1070750757 10:78962732-78962754 AGGGGGTGGCCGGCTGCCCTGGG - Intergenic
1073106717 10:101036480-101036502 AGGCTGTCCCCAGCTGCCTGTGG - Exonic
1075788013 10:125063070-125063092 AGGCTGTGCACAGCTGCCCAGGG - Intronic
1076257772 10:129042219-129042241 AGGGTGTGCCATGCGGGCCTGGG - Intergenic
1076680157 10:132167692-132167714 AGGGAGAGCCCTGCTCCCAGGGG - Intronic
1077162979 11:1121999-1122021 GGAGTGTCCCCTGCTGCCCTGGG + Intergenic
1077476727 11:2794011-2794033 AGGATGTGCCCTCGTGCCCTAGG - Intronic
1084364063 11:68686173-68686195 GCGGTGTCCCCTGCTGCCTGAGG + Intronic
1088790808 11:113224498-113224520 TGGCTATGCCCTGCTGCCAGAGG - Intronic
1090875666 11:130786588-130786610 ATGGGGTGCACTGCTGCCCCAGG - Intergenic
1095412467 12:41939136-41939158 AGGGTGGGCCCTTCTGTCCCAGG + Intergenic
1095672493 12:44876755-44876777 GGGGAGTGCCCTGCACCCCGGGG - Exonic
1096156070 12:49342256-49342278 AGGGTCAGCGCTGCCGCCCGCGG + Intergenic
1096977123 12:55705973-55705995 AGGGGGTGCTCTGCTGCTGGGGG - Intronic
1098385047 12:69909736-69909758 AGAGGATGCCCTGCTGGCCGGGG + Intronic
1098566626 12:71944592-71944614 AGGATGTGCCCTGGTTCCCTCGG + Exonic
1098891504 12:76014120-76014142 AAGGTGAGCCCGGCTGCCCTTGG + Intergenic
1104966345 12:132510239-132510261 AGGGTGGGCCCGGCTGCCCCAGG - Intronic
1104970035 12:132527048-132527070 AGAGTGTGCCCTGATGTCTGAGG + Intronic
1106379803 13:29225111-29225133 TGGGTGTGCTCTGCTGCCCAGGG - Intronic
1112385702 13:98937937-98937959 TGGGCCTGCCCTGCTGCCCAGGG - Intronic
1113421951 13:110177878-110177900 CTGGTGAGCCCGGCTGCCCGGGG + Exonic
1113629926 13:111875227-111875249 AGGGTGTGCCCTGGAGAGCGTGG + Intergenic
1115761877 14:36583572-36583594 AGGGTCTGCCATGCTGCGAGCGG - Intergenic
1116476305 14:45344357-45344379 AGGGTGTGCCATGTTACCCTTGG + Intergenic
1116945275 14:50830689-50830711 AGGATGCGCGCTGCAGCCCGCGG - Intronic
1118332201 14:64823492-64823514 AGCTTGTGCCCTGCTGCCTCTGG - Intronic
1118593134 14:67416287-67416309 AGGCTGAGCCCTGCTACCTGGGG + Intergenic
1121255076 14:92525164-92525186 AGGGTGCTCCTTGCTGCCCATGG - Intronic
1122060532 14:99133981-99134003 CAGGTGTGCCCTCCTGCCCCGGG - Intergenic
1122864497 14:104597356-104597378 AAGGTGTGACCTGCAGCCCAGGG - Intronic
1123695367 15:22875238-22875260 AGTGTGTGACCTGCTGCACGCGG - Exonic
1125324353 15:38521546-38521568 AGAGGGTGCCCTGCTCCCTGTGG - Intronic
1126371379 15:47950610-47950632 AGGGTGTGGCCATCTGCCTGTGG - Intergenic
1127966941 15:63929622-63929644 AGGGTGTCCCTTGCTGGTCGGGG - Intronic
1130015065 15:80180047-80180069 AGGCTGTGCCCAGCTGCCTCCGG + Intronic
1130546410 15:84859905-84859927 TGAGTGTGCCCCGCGGCCCGGGG + Intronic
1132769177 16:1551464-1551486 AGGGTCTCCCCTGCTACCTGCGG - Intronic
1133381735 16:5336624-5336646 AGGGTGTGCTTGGCTGCCCTTGG + Intergenic
1134032712 16:11005304-11005326 AAGCTGTGCCCAGCTGCCCTGGG + Intronic
1135969393 16:27061332-27061354 AGGGTGGGCCCTGTGGGCCGTGG - Intergenic
1137251287 16:46742858-46742880 AGGCTCTGTCCTGCTGCCCCCGG + Intronic
1138543290 16:57701460-57701482 AGGGGAGGCCCGGCTGCCCGTGG + Intronic
1139365725 16:66432363-66432385 AAGGTGTTGCCTGCTGCCTGAGG + Intronic
1140476039 16:75239689-75239711 GGGGTGTGTCCTGGTGGCCGTGG - Intronic
1142027052 16:87820012-87820034 AGGGTCTCTCCTGCTGCCCCAGG - Intergenic
1203145324 16_KI270728v1_random:1794895-1794917 AGGGTGGGCCCTGCAGGCCGTGG + Intergenic
1143452001 17:7042146-7042168 GGGGGGTCCCCTGCTGGCCGCGG - Exonic
1145780670 17:27560853-27560875 AGGGTGTGTGCTGCTTCCTGGGG - Intronic
1145788230 17:27608014-27608036 AGGGGGTGCCCAGCTGCTGGGGG + Intronic
1146283458 17:31559538-31559560 AGGGTGCGGCCTGCTGCGAGAGG + Intergenic
1146534790 17:33640798-33640820 AGGCTGAGCCCTGCTGCCCCTGG + Intronic
1147553224 17:41460006-41460028 AGGGTCTTCCTTGCTGACCGGGG + Exonic
1153753889 18:8260848-8260870 AGGGGGAGCCCAGATGCCCGGGG - Intronic
1153865561 18:9265190-9265212 TGGCTGTGCCCTGCTCCCAGAGG - Intronic
1155611720 18:27674125-27674147 CGGGTGGGCCCTGCTGGCCCCGG - Intergenic
1158239589 18:55361646-55361668 AGGGAGTGGCCTGAAGCCCGGGG - Intronic
1160528938 18:79552504-79552526 AGGGTGGGGCCTGCAGCCCACGG - Intergenic
1160726482 19:619933-619955 AGGGTGTGCCCTGCTGCCCGGGG - Intronic
1161040511 19:2108659-2108681 AGGGTGTGCACAGCAGCCCGAGG + Intronic
1161319373 19:3633904-3633926 AGCCTGTGCGCTGGTGCCCGTGG - Intronic
1161324217 19:3655746-3655768 AGGCTGTGCTGTGCTGCCCAGGG + Intronic
1162043519 19:7984500-7984522 TGGCTCTGCCCTGCTGCCAGTGG - Intronic
1163315332 19:16537186-16537208 AGGGTGTCCTCAGCTGCCTGGGG - Intronic
1163695454 19:18761290-18761312 AGTGTGTGACCTGCATCCCGGGG + Intronic
1164604858 19:29590463-29590485 AGAGTGCTCCCTGCTGCCTGGGG + Intergenic
1167406264 19:49310616-49310638 TGGGTGAGCCCTGATGCCTGTGG - Intronic
925044484 2:761618-761640 TGGGTGAGCCCTGCTGACCTGGG - Intergenic
925315840 2:2922356-2922378 ATGGTGTGCCCTGCATCCCATGG - Intergenic
925342529 2:3147304-3147326 GGGGTGGGCCCAGCTCCCCGAGG - Intergenic
925529530 2:4843943-4843965 AGTCTGTGCCCAGCTGCCCTAGG - Intergenic
926246396 2:11124649-11124671 AGGGTGCCCCCTGCTGCCTCCGG + Intergenic
927956538 2:27211441-27211463 AGGGAGTGCGTTGCTGCCCCAGG - Intronic
928314029 2:30232284-30232306 AGCGCGTGCCCTGCTGCTTGTGG - Intronic
929668876 2:43853824-43853846 AGGGTGTGGGCTGCTGGACGAGG - Intronic
930198716 2:48532690-48532712 AGAGTCTGCCCAGCAGCCCGAGG + Intronic
932812122 2:74834408-74834430 AGGGTGCGCCCGGCTGGCGGAGG - Exonic
936382943 2:112003773-112003795 AGGCTCTGCCTGGCTGCCCGTGG + Intronic
940354068 2:152718905-152718927 AGGCTGGGCTCTGCTGCCCGCGG - Exonic
940707845 2:157126507-157126529 TGGTTCTGCCCTGCTGCCCTTGG + Intergenic
942346262 2:175005470-175005492 AGGGTGCGCCCTCATTCCCGCGG + Intergenic
942565079 2:177257950-177257972 AGGTTGTGGACTGCTGCCCTAGG + Intronic
946422481 2:219572415-219572437 AGGGTGGGCACAGCTGCCAGGGG + Exonic
947752666 2:232540894-232540916 AGGGTCTGCTCTGCTGGCCCTGG - Intronic
948383398 2:237566946-237566968 AGGGTGTGCTGTGCTCCCAGAGG - Intronic
1169924510 20:10768786-10768808 AGGGGGTGTCCTGCTGCCAGAGG - Intergenic
1170588094 20:17750572-17750594 AGGGATTTCCCTGCTTCCCGTGG - Intergenic
1173257170 20:41402031-41402053 TGGGTGTCTCCTGCTGCCTGGGG - Intergenic
1173864802 20:46307229-46307251 AGGGGGTGCCCTGCACCTCGGGG + Intronic
1176231680 20:64036230-64036252 AGGGTGTGCACTGCCGCACCAGG - Intronic
1176915586 21:14621689-14621711 TGGCTATGCCCTGCTGCCAGAGG - Intronic
1180148914 21:45937730-45937752 AGGCTGAGCCCTGCAGCCCAAGG - Intronic
1180997936 22:19974719-19974741 AGGGTGGGCCCTGTTGCTAGGGG - Intronic
1181555771 22:23670960-23670982 AGGGGGTGCCCAGCAGCCCTGGG + Intergenic
1181646489 22:24233976-24233998 CGGGTGAGCCCTGCTGCTGGAGG + Exonic
1183381541 22:37492734-37492756 GGTGTCTGCCCTGCGGCCCGTGG - Exonic
1184339238 22:43876961-43876983 TGGGTGTTTCCTGCTGCCTGAGG - Intergenic
1184802274 22:46768735-46768757 AGGGTGTGGTCTGCTGACAGAGG + Intronic
953556393 3:43949842-43949864 TTGGTGTCCCATGCTGCCCGGGG - Intergenic
953707590 3:45243108-45243130 AGGGTGGGCCATGCAGCCGGAGG + Intergenic
954613500 3:51958225-51958247 AGGGTGTGCCCAGCAGGCCAGGG + Exonic
955650777 3:61191716-61191738 TGGGTCTGCCCAGCTGCCCTTGG - Intronic
960955515 3:123027926-123027948 AGGGGGCGCCCTGCATCCCGCGG + Intronic
961081515 3:124032905-124032927 GGCGTGTGCCCTGCAGCCCCGGG + Intergenic
961456737 3:127028293-127028315 AGGGCGTGCCCTACTCCCAGCGG + Exonic
964049941 3:152378741-152378763 AGGTCTTGCCCTGCTGCCCAGGG + Intronic
967886779 3:194338704-194338726 CCAGTGTGCCCTGCTCCCCGGGG + Intergenic
968501688 4:953102-953124 TGCGTGTGCCATGCAGCCCGGGG + Intronic
968731718 4:2272240-2272262 AGGGTATGCCCTGCTGGGCCAGG + Intronic
968934925 4:3604916-3604938 AGGGTGAGCTGAGCTGCCCGAGG + Intergenic
971195627 4:24470494-24470516 GGAGGGTGCCCGGCTGCCCGTGG - Intergenic
972643005 4:40942684-40942706 AGGGTGTGCCCTTCTGAGCCTGG + Intronic
975368030 4:73551180-73551202 TGTGTGTGCCCTGCTCCCAGAGG - Intergenic
983832430 4:172344543-172344565 ATTGTCTGCCCTGCTGCCAGAGG + Intronic
995079841 5:108036716-108036738 AGCGTGAGTCCTGCTGCCAGTGG - Intronic
997787056 5:136723082-136723104 AAGGTGTGCCCTGCTGTACCAGG + Intergenic
998128739 5:139640585-139640607 AGGGTGTGCCCTCATTCCTGGGG + Intergenic
1000350605 5:160349656-160349678 CTGGTGTGCCATGCTTCCCGGGG + Exonic
1001942522 5:175750731-175750753 ATGGTGGTCCCTGCCGCCCGGGG - Intergenic
1002859168 6:1064811-1064833 AGGCTCTGTCCTGCTGCCCTGGG - Intergenic
1004233060 6:13850241-13850263 AGGGAGGGCCCTGCTGTCCTGGG + Intergenic
1007790870 6:44307377-44307399 AGGGGGTGCCCTGCAGCCCTGGG + Exonic
1008921439 6:56847291-56847313 AGGGTTTGCTCTGTTGCCCAGGG - Intronic
1010229711 6:73523597-73523619 AGGGTGCGCCCCGGTGCGCGCGG - Intronic
1018302369 6:162417360-162417382 AGGGGATGCCCGGCTGCCGGGGG - Intronic
1018628844 6:165805203-165805225 AGTGGGTGCCCTGCGACCCGAGG - Intronic
1019274523 7:168761-168783 AGGGATGTCCCTGCTGCCCGAGG + Intergenic
1019427916 7:986064-986086 AGGGAATGCTCTGCTGCCCTGGG - Intronic
1020383142 7:7567284-7567306 AGCGTGTTCCCTGCGCCCCGAGG - Intronic
1023930255 7:44701061-44701083 AGGGAGTGCCCTGCTGCCCTGGG + Intronic
1024246668 7:47475935-47475957 AGCGTGTCCCCTGCTTCCTGAGG - Intronic
1024255383 7:47536925-47536947 CGGGTGTGCACTGGTGCCCGTGG - Intronic
1027187881 7:75982543-75982565 GGGATGTGCCCCGCTGCCCTGGG - Intronic
1032306260 7:130734274-130734296 AGGGGGTGTCCTGCGGGCCGGGG - Intergenic
1033047889 7:137979092-137979114 CTGGTGTGCCCTGCTGACAGAGG + Intronic
1035153626 7:156894660-156894682 AGCATGTGCCCTGCTGCCACAGG + Intergenic
1035628216 8:1089485-1089507 AGGGTCTCTCCTGCTGCCCCAGG + Intergenic
1035719353 8:1780034-1780056 AGGGTCAGCCCTGCTGGCCCAGG + Intronic
1036682514 8:10885899-10885921 AGGGTGTGGCGTGCGGCCAGTGG - Intergenic
1037579735 8:20237264-20237286 AGCAGGTGCCCTGGTGCCCGTGG + Intergenic
1039070283 8:33643409-33643431 CGGGTGTGCACTGCTGCACCTGG + Intergenic
1039925316 8:41925918-41925940 GGGGTCTGCCTTGCTGCCAGCGG - Intergenic
1045399395 8:101797105-101797127 AGGCTGTGCCCTGATGTCCTTGG + Intronic
1047416210 8:124666744-124666766 AGAGTGAGCCCAGCTGGCCGAGG + Intronic
1048512425 8:135074910-135074932 TGGGTGGGCCCTGCTTCCCAAGG + Intergenic
1048583986 8:135755776-135755798 AGGGTGGGCCCTGCTTCTCTGGG + Intergenic
1049685715 8:143938550-143938572 AGGGTGGCCCCTGCCGCCCAAGG - Intronic
1054455250 9:65427062-65427084 AGGGTGAGCTGAGCTGCCCGAGG - Intergenic
1056078244 9:83062905-83062927 AGGGAGGGCCCTGCGCCCCGCGG - Exonic
1057165974 9:92925751-92925773 AAGGTGTGTCCTTGTGCCCGAGG + Intergenic
1057320876 9:94011335-94011357 AGGGTGTGCCCTCCAGACTGTGG - Intergenic
1060493279 9:124100367-124100389 AGGCTGTGCCCAGCAGCCTGGGG - Intergenic
1061796492 9:133088470-133088492 AGGGTGTCCCCTGCTTCTCCAGG - Intergenic
1062023473 9:134329896-134329918 GGGGTGTGCCCCTCTGCCCCTGG + Intronic
1062190450 9:135245349-135245371 AGGGCCTGCCCCACTGCCCGAGG + Intergenic
1062318976 9:135981279-135981301 TGGGGGAGCCCTGCTGCCCTGGG + Intergenic
1062698450 9:137887191-137887213 AGGCTGTGCACTGCGCCCCGTGG + Intronic
1185461104 X:333116-333138 AGGGTGGGCCCTGCGGGCCGTGG + Intergenic
1185747592 X:2584583-2584605 CGGCTGCGCGCTGCTGCCCGCGG - Intergenic
1187476301 X:19614111-19614133 AGTGTGTGAGCTGCTGCCAGGGG - Intronic
1190025238 X:46915968-46915990 TGGCTGTGCCCTGCTACCCAAGG + Intronic
1190047273 X:47122646-47122668 AGGTTTTGCCATGTTGCCCGTGG - Intergenic
1190246585 X:48694958-48694980 TGGGAGAGCCCTGCTGCCCGAGG + Intergenic
1190641269 X:52483779-52483801 AGAGAGTGTCCTGCTGCCCGGGG - Intergenic
1190646403 X:52529086-52529108 AGAGAGTGTCCTGCTGCCCGGGG + Intergenic
1193360633 X:80574758-80574780 AGGGTGCGCCCGGCTGGCGGAGG + Intergenic
1196456617 X:115895710-115895732 ATGGTGTGCACTGCAGCCAGGGG + Intergenic
1196848197 X:119913483-119913505 AGGGTGTGCCTTGCTGGGCATGG + Intronic
1197705603 X:129632468-129632490 AGCGTGTGGGCTGCTGCCAGTGG - Intergenic
1199743484 X:150757284-150757306 TGGGTGCGCCCCGCTGCCCCAGG + Intronic
1199948935 X:152690054-152690076 AGGCTGTGCCCTACTTCCAGTGG + Intergenic
1199960741 X:152778395-152778417 AGGCTGTGCCCTACTTCCAGTGG - Intergenic
1200033286 X:153312983-153313005 AGGGTCTGCCCTGCAGGCCCAGG + Intergenic
1201018001 Y:9624529-9624551 AGGGGATGCCCTGCAGCCTGCGG - Intergenic