ID: 1160727112

View in Genome Browser
Species Human (GRCh38)
Location 19:622273-622295
Sequence CTGCCAGTGCAGATGGAGCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 2, 1: 0, 2: 1, 3: 29, 4: 254}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160727112_1160727121 0 Left 1160727112 19:622273-622295 CCCAGCTCCATCTGCACTGGCAG 0: 2
1: 0
2: 1
3: 29
4: 254
Right 1160727121 19:622296-622318 GGGCCAGGGCTGCTCCCGCAGGG 0: 2
1: 0
2: 1
3: 30
4: 320
1160727112_1160727123 6 Left 1160727112 19:622273-622295 CCCAGCTCCATCTGCACTGGCAG 0: 2
1: 0
2: 1
3: 29
4: 254
Right 1160727123 19:622302-622324 GGGCTGCTCCCGCAGGGCCTCGG 0: 2
1: 0
2: 6
3: 88
4: 485
1160727112_1160727120 -1 Left 1160727112 19:622273-622295 CCCAGCTCCATCTGCACTGGCAG 0: 2
1: 0
2: 1
3: 29
4: 254
Right 1160727120 19:622295-622317 GGGGCCAGGGCTGCTCCCGCAGG 0: 2
1: 0
2: 1
3: 48
4: 432
1160727112_1160727124 7 Left 1160727112 19:622273-622295 CCCAGCTCCATCTGCACTGGCAG 0: 2
1: 0
2: 1
3: 29
4: 254
Right 1160727124 19:622303-622325 GGCTGCTCCCGCAGGGCCTCGGG 0: 2
1: 0
2: 5
3: 26
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160727112 Original CRISPR CTGCCAGTGCAGATGGAGCT GGG (reversed) Exonic
900288029 1:1911077-1911099 CTACCAGGGCAGGTGGGGCTCGG + Intergenic
900570869 1:3357574-3357596 CAGCCAGTGCTGATGGAGAGGGG + Intronic
900694996 1:4004290-4004312 CGGCCAGTGCAGAAGGTGCTTGG - Intergenic
901181715 1:7346700-7346722 CTGCCAGGCCCCATGGAGCTGGG - Intronic
901777627 1:11571113-11571135 CAGCCAGTGCAGAGAGAACTGGG + Intergenic
902232389 1:15036279-15036301 CGGGCAGGGCAGAGGGAGCTGGG - Intronic
903275637 1:22219573-22219595 CGGCCAGGGCAGAAGGACCTTGG - Intergenic
903576710 1:24343892-24343914 CGGCCAGTGCTGACAGAGCTTGG + Intronic
903976059 1:27150996-27151018 CTGAGAGTGCAGAGGGAGCATGG + Intronic
904756091 1:32769765-32769787 CAGCATGTGCAGAAGGAGCTTGG + Exonic
905118200 1:35660588-35660610 CTGTAAGTCCAGATGGACCTTGG - Intergenic
905187271 1:36205464-36205486 ATGTCAGTGCAGGTGGAGCAGGG + Intergenic
906685066 1:47757820-47757842 CTGGCAGAGCAGATGGGGGTGGG + Intergenic
912411048 1:109480928-109480950 TGGCCAGGGCAGATTGAGCTGGG - Exonic
912739149 1:112177520-112177542 TTGCCAGTGCAAGAGGAGCTAGG + Intergenic
914717072 1:150262218-150262240 ACCCCAGTGCAGGTGGAGCTGGG - Exonic
916090613 1:161305638-161305660 CTGCCAGAGCAGGGGGACCTAGG - Exonic
917968836 1:180194706-180194728 CTGCTAGGGCAGAGGGAGCTGGG + Intronic
918152756 1:181812489-181812511 CTCCCAGTGAAGATGGAGGTGGG - Intergenic
919881369 1:201903353-201903375 CCTCCAGTGCAGCTGGACCTTGG - Intronic
920631685 1:207659069-207659091 CTGCAATTGTAGCTGGAGCTGGG - Intronic
921122312 1:212147729-212147751 CTGGCAGTGCAGATTAATCTAGG + Intergenic
922287235 1:224181088-224181110 CTGCCAATCCAGATGAAACTTGG + Intronic
922289491 1:224198655-224198677 CTGCCAATCCAGATGAAACTTGG - Intergenic
924420269 1:243902835-243902857 CTGCCACTGCAGCTGAAGATGGG - Intergenic
1066438507 10:35415496-35415518 CTCTCAGAGGAGATGGAGCTGGG + Intronic
1066615641 10:37290973-37290995 CTGCCAATGGAGATGGAGGAAGG + Intronic
1066640567 10:37550852-37550874 CTGGGACTGCAGAAGGAGCTTGG - Intergenic
1066656828 10:37704677-37704699 CTGCCAGGGCAGAGTGAGTTGGG + Intergenic
1067064573 10:43096556-43096578 CGGCCAGTGCAGGTGCAGCCAGG - Intronic
1067657871 10:48210986-48211008 CTGCCTGTGCAGATACAGCTGGG - Intronic
1069411097 10:68154293-68154315 CTGCCAGAGCAGCTGCTGCTGGG - Intronic
1069583584 10:69581593-69581615 CTGCCAGTGCTGAAGGGGCAGGG + Intergenic
1069774006 10:70916430-70916452 CTGGCAGTCCAGGTGGAGCAGGG + Intergenic
1070794024 10:79206621-79206643 CTGCCTTTGCAGAAGGAGCCAGG + Intronic
1071467462 10:85954704-85954726 CTGCCAGTTCGGAAGGACCTGGG - Intronic
1072307801 10:94124086-94124108 CTGCCACTGAAGAAGGGGCTGGG + Intronic
1072950274 10:99840900-99840922 CTGCCAGTGAGGATGGAGATAGG + Intronic
1073477756 10:103765510-103765532 CTGTCAGAGCTGATGGGGCTGGG - Intronic
1074455823 10:113594442-113594464 CTGCCAGTGCATTTGGGGCCCGG - Intronic
1074966571 10:118496005-118496027 CCTCCACCGCAGATGGAGCTTGG - Intergenic
1074974957 10:118572632-118572654 CTGCCAGTATCCATGGAGCTGGG + Intergenic
1075730306 10:124631792-124631814 CTGCCAGTGAAGAGGGAGACAGG - Intronic
1076140830 10:128077543-128077565 CTGAGAGGGCAGATGGGGCTGGG + Intronic
1076481411 10:130787459-130787481 CTTCCAGAGCAGATTGAGCAGGG + Intergenic
1076485968 10:130817361-130817383 CTGCCAGAGCCAATGAAGCTGGG - Intergenic
1076815621 10:132913388-132913410 CTGTAAATGCAGATGGAGTTTGG - Intronic
1077091244 11:779312-779334 GGGCCAGTGCAGGTGGGGCTGGG - Intronic
1079665270 11:23096712-23096734 CTGTCAGTTCAGTTAGAGCTGGG + Intergenic
1081029574 11:38061701-38061723 CTGACAAAGCAGATGGAGTTGGG - Intergenic
1082894896 11:58179688-58179710 CTGGCAGTGCTGCTGGAGCATGG + Exonic
1083499177 11:63087713-63087735 CTGCCTGGGACGATGGAGCTTGG + Intronic
1083831604 11:65237017-65237039 AAGCCAGTGCAGATGGAGGTGGG - Intergenic
1086241478 11:84698305-84698327 CTGCCTGTGAACATTGAGCTAGG + Intronic
1086243080 11:84720039-84720061 CTACAAGAGCAGATGCAGCTCGG - Intronic
1086836449 11:91630006-91630028 CTGCCAGCGCATATGCATCTCGG + Intergenic
1088180505 11:107103939-107103961 CCACCACTGCAGATGCAGCTGGG + Intergenic
1089078052 11:115754521-115754543 CTTCCACTGAAGATGGGGCTGGG + Intergenic
1089977913 11:122748436-122748458 CTCCGAGTGCACAGGGAGCTGGG - Intronic
1090091895 11:123705340-123705362 CTGCCTGTGTAGATGGCTCTAGG - Intergenic
1091187761 11:133661890-133661912 CTGCCACAGCAGAGGGAGCGGGG + Intergenic
1091330311 11:134726737-134726759 CAGCCAGTGCAGAAGCACCTGGG + Intergenic
1093668046 12:21838122-21838144 GTGACAGAGCAGAGGGAGCTGGG + Exonic
1094331839 12:29302449-29302471 CTGGCAGGGCAGCTGGAGCTGGG + Intronic
1096509814 12:52121531-52121553 AGGCCAGTGCGGCTGGAGCTGGG - Intergenic
1096555477 12:52400990-52401012 CTGCCCGAGCAGCTGGAGATGGG - Intronic
1096838039 12:54363591-54363613 GCGCCAGTGCAGGTGGAGGTAGG + Exonic
1101681867 12:106976170-106976192 CAGCCAGTACAGTTGGAGCAGGG - Intronic
1104081002 12:125430539-125430561 CTCCCAGGGAAGGTGGAGCTGGG + Intronic
1104997488 12:132667688-132667710 CTCCCAGAGCAGAGGGAGCCAGG + Intronic
1106418877 13:29569189-29569211 CTGCCAGTGCCCAGAGAGCTCGG - Intronic
1107181786 13:37469829-37469851 CTGCCAGTGCAGCTGGAACAAGG + Intergenic
1109391972 13:61705505-61705527 CTGATGGTGCAGATGGAGCTGGG - Intergenic
1110158436 13:72346049-72346071 CTGCCAGTGCCAATGCTGCTTGG - Intergenic
1112562868 13:100529333-100529355 CGGCCACTGCAGATGCTGCTTGG - Intronic
1113201860 13:107875178-107875200 CTGCCAGCTCAGATGTCGCTGGG - Intergenic
1113259860 13:108549780-108549802 CTTCTAGTGCAGGAGGAGCTGGG - Intergenic
1113762688 13:112860673-112860695 CTGACAGTCCTGAGGGAGCTGGG + Intronic
1113910886 13:113840721-113840743 CTGGCAGAGCAGAAGCAGCTCGG + Intronic
1117292396 14:54346259-54346281 CTTCCAGAGCAGATGGCCCTTGG - Intergenic
1119682699 14:76604806-76604828 CTCCCAGTTCAGATGGGGCTTGG + Intergenic
1120087573 14:80291945-80291967 GTTCCAGTGCATCTGGAGCTAGG - Intronic
1122810543 14:104285550-104285572 CTGTCATTGCAGATGAAGCCTGG - Intergenic
1122837492 14:104437303-104437325 CTTCCAGGGCAGGTGGGGCTGGG - Intergenic
1122886357 14:104712146-104712168 CTTCCAGGGCAGGTGGAGCCCGG - Intronic
1125685838 15:41562740-41562762 CTGGGAGTGGAGAAGGAGCTGGG + Intronic
1127290846 15:57569680-57569702 CTGCCAGTGCTCTTGGAGCTGGG - Intergenic
1128596558 15:68956980-68957002 TTGCTAGTGCGGATGGAGATTGG + Intronic
1128726236 15:69990614-69990636 CTGCCTGTGCATGAGGAGCTGGG + Intergenic
1129706669 15:77798378-77798400 CTGCCAGCTCAGGTGGAGCTGGG - Intronic
1130032349 15:80327517-80327539 CTGCCAGGGCAGGTGGGGATGGG + Intergenic
1131434668 15:92413399-92413421 CTGCGAGTTAAGGTGGAGCTAGG + Intronic
1132028610 15:98422478-98422500 CTGCCATTGTAGGTGGAGCAGGG - Intergenic
1132990705 16:2791403-2791425 CTGCCTGTTCAGCGGGAGCTGGG + Intergenic
1132990710 16:2791429-2791451 CTGCCTGTTCAGCGGGAGCTGGG + Intergenic
1133055175 16:3142192-3142214 GCGCCAGTGCCGATGGAGCAGGG - Exonic
1136079556 16:27842742-27842764 CAGAGAGTGGAGATGGAGCTGGG + Intronic
1136577844 16:31134946-31134968 CTGCCAGTGAAGGTGCAGCTGGG - Intronic
1137290906 16:47051314-47051336 CTAGCAGGGCAGAAGGAGCTGGG - Intergenic
1138594561 16:58022904-58022926 CTGACAGTGCAGAAGCAGCCGGG + Intergenic
1140919044 16:79519971-79519993 CTGTCTGTGCAGGTGGAGTTGGG + Intergenic
1141423691 16:83932460-83932482 CTGCCTCTGCTGGTGGAGCTGGG - Intronic
1144753292 17:17664845-17664867 GTGCCACTGCCCATGGAGCTTGG + Intergenic
1147246348 17:39123669-39123691 CTGACGTTTCAGATGGAGCTGGG - Intronic
1147817155 17:43218297-43218319 CAGCCAGCCCTGATGGAGCTGGG - Exonic
1147901875 17:43792094-43792116 CTGCTAGTTGAGATGGGGCTTGG + Intergenic
1147999616 17:44380122-44380144 CTGCCGGTCCAGCTGCAGCTCGG + Exonic
1148345577 17:46901485-46901507 GAGCCAATGCAGCTGGAGCTGGG + Intergenic
1149551602 17:57544512-57544534 CTGCCAGGGCAGTAGCAGCTGGG + Intronic
1150069415 17:62138936-62138958 CTGCCAGTGCAGATGGAGCTGGG - Intergenic
1150621306 17:66809664-66809686 CTGCAAGTTCAGGTGGAACTTGG + Exonic
1150905552 17:69333013-69333035 CTGGCAGTGAAGATGGAGGAAGG + Intergenic
1152274853 17:79350175-79350197 CTGCCAGGGCAGCTGCAGCCAGG - Intronic
1152539103 17:80965988-80966010 CTGCGTGTGCGGGTGGAGCTGGG - Exonic
1153516016 18:5901940-5901962 CTGCCACTACAGATGTTGCTTGG + Intergenic
1153660688 18:7323259-7323281 CTTCCAGGGGAGAGGGAGCTGGG - Intergenic
1154274076 18:12944853-12944875 CTGCTAGTACTGCTGGAGCTAGG - Intergenic
1157571391 18:48714630-48714652 CTGAGAGTGCAGCTGGAACTGGG - Intronic
1158068263 18:53439460-53439482 CAGCAAGTGTAGAGGGAGCTAGG - Intronic
1158367032 18:56747724-56747746 CAGCCTGTGCAGATGCAGGTGGG + Intronic
1160198899 18:76779885-76779907 CTGGCTGTGCAGATGGAGGAAGG + Intergenic
1160727112 19:622273-622295 CTGCCAGTGCAGATGGAGCTGGG - Exonic
1161014440 19:1976687-1976709 CTGCCAGTCCAGCTGCAGCAGGG + Intronic
1161118540 19:2512698-2512720 CTGCCAGGGCAGAGGGAGGAGGG - Exonic
1163011445 19:14429084-14429106 CTGCCTCCCCAGATGGAGCTGGG - Intergenic
1163133091 19:15288747-15288769 CTGCCCCTGCAGATGGAGGAGGG + Intronic
1163237321 19:16037315-16037337 CTGCATGTGCTGCTGGAGCTGGG + Intergenic
1163650363 19:18514118-18514140 CTGCCAGGTCAGATGGAGGCGGG + Intronic
1163692113 19:18743689-18743711 CTGACAGGCCAGATGGAGCCGGG + Intronic
1164144143 19:22499886-22499908 CTGCCAGTCCTGTTGGATCTGGG - Intronic
1164604438 19:29587269-29587291 CTGCCAGAGAAGATTGAGGTGGG + Intergenic
1166313843 19:41977843-41977865 CAGGCAGTGCAGAGGGAGGTTGG + Intronic
1166729256 19:45049310-45049332 GTCCCAGGGCAGAGGGAGCTGGG + Intronic
1167362946 19:49039937-49039959 CTGGCAGTGCAGGTGGGGCGGGG + Intergenic
1167424985 19:49425607-49425629 CTGTTATTGAAGATGGAGCTAGG - Intronic
1168505059 19:56927012-56927034 GTGTCAGTGCATATGGAGCTTGG - Intergenic
926125736 2:10270614-10270636 CTTCCAGTGTAAATGGAGGTAGG - Intergenic
926242833 2:11101363-11101385 CTGCCATAACACATGGAGCTGGG - Intergenic
926686360 2:15701352-15701374 CAGCAAGTGCAGACAGAGCTGGG - Exonic
927010312 2:18897252-18897274 CTGTCATTGCAGATGGGACTTGG + Intergenic
927252017 2:21004383-21004405 CTGGTAGCGCAGATGGAGATCGG + Exonic
929919355 2:46161528-46161550 CTGCCAGTACAGCTGGGGCCTGG - Intronic
932316010 2:70783518-70783540 CTGCCAGTCCTGTTGGACCTGGG - Intronic
932624449 2:73286062-73286084 CTGCAAGAGCAGATGGATTTGGG - Intergenic
934158022 2:89221340-89221362 CTGACAGTGCAGAGGCAGGTGGG - Intergenic
934209243 2:89961084-89961106 CTGACAGTGCAGAGGCAGGTGGG + Intergenic
935106607 2:100050784-100050806 CTGCCCCTGCAGATGCAGATGGG + Intronic
935194190 2:100802254-100802276 TTGCCAGGGCAGATGCAGCCAGG - Intergenic
938214621 2:129500681-129500703 CCTGCAGTGCAGATGGAGATAGG - Intergenic
944778080 2:202989447-202989469 TTGAAAGTGCAGGTGGAGCTGGG - Intronic
944796892 2:203196216-203196238 CTGCACCTGCAGATGGAACTTGG - Intronic
946363508 2:219234052-219234074 CTCTCAATGCAGATGTAGCTGGG - Intronic
947246659 2:228055998-228056020 CTGTCATTGAAGATGGAGCAAGG - Intronic
948295237 2:236855663-236855685 CTGGCTGTGCAGATGGAGGAAGG - Intergenic
948578488 2:238969092-238969114 CTGCGACTCCTGATGGAGCTGGG - Intergenic
1168963882 20:1887234-1887256 CTGCCACTGCTGCTGGAGCAAGG - Intergenic
1171109247 20:22465242-22465264 CTGCCAGAGGAGAAGGAGGTGGG - Intergenic
1171215206 20:23347426-23347448 CTGCCAGTTCAGAGTGAGCTGGG - Intergenic
1172125396 20:32622537-32622559 CTGGCAGTGCAGACAGAGCCTGG + Intergenic
1175979060 20:62727950-62727972 CTGTCACAGCAGATGGTGCTGGG + Intronic
1176111073 20:63411023-63411045 CTGCCAGCTCACGTGGAGCTGGG + Intronic
1176936198 21:14870049-14870071 CTGCTATTGCAGATGGAACTGGG - Intergenic
1177241903 21:18469111-18469133 CTGGCAGTGCAGCTGTAGTTAGG - Intronic
1179251742 21:39676383-39676405 TTGTCAGTGCAGATGGAGACTGG + Intergenic
1183035454 22:35137783-35137805 CTGCCAGTGGACATGGAGGATGG + Intergenic
1183468003 22:37989790-37989812 CTGCAAGTGCAGCTGCAGGTTGG + Intronic
1184301447 22:43563129-43563151 CTGCCAGGGCAGAAGGAACGCGG + Intronic
1184631186 22:45781238-45781260 GTGTCAGAGAAGATGGAGCTGGG + Intronic
1184798614 22:46746786-46746808 CAGCGAGCGCAGGTGGAGCTGGG - Intergenic
1184902896 22:47458515-47458537 CTGCTTCTGCAGATGGGGCTGGG - Intergenic
949536677 3:5001559-5001581 ATGCCACTGCACATGCAGCTTGG + Intergenic
949764274 3:7508869-7508891 TTGCCAATGCAGATGGACTTAGG - Intronic
950434952 3:12973910-12973932 TTAGCAGTGCAGAAGGAGCTGGG - Intronic
951301277 3:21000198-21000220 CTGCCTGTGCTGATGGAGCAAGG + Intergenic
952918872 3:38270871-38270893 CTGGCATTGCAGTTGGAACTTGG + Intronic
953130445 3:40132849-40132871 CTGGCAGTCCAGCTGGGGCTTGG + Intronic
954464047 3:50644296-50644318 ATCCCAGTGCAGAAGGAGCCAGG - Intronic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
954649221 3:52150076-52150098 ATGCCAGGGAAGATGGAGCTGGG - Intronic
954749431 3:52805292-52805314 GTGCCAGTCCAAATGGAGGTGGG - Intronic
954990284 3:54835025-54835047 CTGCCAGTCTAGATGTTGCTGGG - Intronic
955340075 3:58118366-58118388 CAGCCAGTGCAGCTGGGCCTGGG - Intronic
956086840 3:65620432-65620454 CTGACAGTGCAGAAGAAGCAGGG + Intronic
958847821 3:99286394-99286416 CTTCCAGAGCAAATGGACCTTGG + Intergenic
959783622 3:110266701-110266723 CTGTCAATGAAGATGTAGCTTGG - Intergenic
961107625 3:124255719-124255741 ATCCCAGTGCAGATGGAGCAGGG + Intronic
962266678 3:133948942-133948964 CTGCCACAGCAGATGAAGCAAGG - Exonic
962771656 3:138616081-138616103 CTGGCAGTGGAGATGGCACTTGG + Intronic
962806837 3:138933543-138933565 CTGCCTCTGGAGATGGCGCTTGG - Intergenic
962850101 3:139301862-139301884 CTGTTAGTGCTGATGCAGCTGGG - Intronic
962974179 3:140431731-140431753 AAACCAGTGGAGATGGAGCTAGG + Intronic
963617851 3:147566084-147566106 CTGCCCTTGTAGATGGAGTTAGG - Intergenic
966736082 3:183188227-183188249 CTGCCACTGCAGTTGGTCCTTGG - Intronic
966965731 3:184990539-184990561 CTAACTGTGCAGATTGAGCTGGG + Intronic
969064116 4:4464228-4464250 AAGCCAGTGCAAATGGAGCTAGG + Intronic
969662259 4:8537154-8537176 CTGCTTGTGCTGGTGGAGCTGGG + Intergenic
972542960 4:40056014-40056036 CTGGCAGGGCCGATGGGGCTGGG + Intergenic
972634360 4:40870255-40870277 CTGCCAGTGCAGATGAGGGAGGG + Intronic
972764897 4:42143548-42143570 CTGGCAGTGTAGATGAAGATGGG + Exonic
972936953 4:44147835-44147857 CTGCTAGTGCAGATGATGCATGG - Intergenic
973021748 4:45211363-45211385 CTTCCAGTTCAGATGGTGTTGGG - Intergenic
974302388 4:60084841-60084863 CTGCCAGTCCATCTGGTGCTGGG - Intergenic
974856412 4:67466363-67466385 CTACCACTGCAGACAGAGCTGGG + Intergenic
981915346 4:150026982-150027004 TTGCCACTGCTGATGCAGCTGGG - Intergenic
982287811 4:153753423-153753445 CTGCCAGGGAGGATGGTGCTAGG - Intronic
985337389 4:188911432-188911454 ATGCAGGTGCAGATGGAGGTTGG - Intergenic
987572864 5:19687605-19687627 CTGCCACTGCTGGTGGAGGTAGG - Intronic
989456185 5:41646986-41647008 CTGCCAGTGGAGCTGGAGCAAGG - Intergenic
990611154 5:57458087-57458109 CCCCCAGGCCAGATGGAGCTAGG - Intergenic
993364624 5:87020363-87020385 CAGCCATTGCAGCTGGAACTGGG - Intergenic
997813374 5:136993737-136993759 CTACCAGTGCAGAGGGAGCCTGG + Intronic
998669365 5:144336198-144336220 TTGCCAATGCTGAAGGAGCTGGG + Intronic
998764499 5:145470564-145470586 CTGCCCTTGCTTATGGAGCTGGG + Intergenic
1001037698 5:168309494-168309516 CTGCCTGTGGAGAGGGGGCTGGG - Intronic
1001142553 5:169157042-169157064 CAGCCAGTGCTGGTGGAGGTGGG - Intronic
1001550396 5:172598404-172598426 TGGCCAGTGCCGACGGAGCTCGG - Intergenic
1003110910 6:3251490-3251512 CTGCAATTGCAGATGAAGCACGG - Intronic
1003179893 6:3782509-3782531 CTGCCAGTGTGGAAGGAGCTGGG + Intergenic
1003816837 6:9851210-9851232 CTGCCATTGCAGTGGGACCTAGG + Intronic
1004831259 6:19478645-19478667 TTTCCAGTGTAGAAGGAGCTGGG - Intergenic
1006743766 6:36326948-36326970 CTGCAAGGACAGGTGGAGCTTGG + Intronic
1006744275 6:36330486-36330508 GAGCCTCTGCAGATGGAGCTGGG + Exonic
1007762127 6:44139346-44139368 CTGCCAGATCAGCTGGAGCTAGG + Intronic
1008079472 6:47179290-47179312 TGGCCTGTGCAGATGGATCTTGG - Intergenic
1008688079 6:53946091-53946113 CTGCCATTGCAGTTGGAGACTGG + Intronic
1009032890 6:58081527-58081549 CCTCCAGTGCAGTTGGTGCTTGG + Intergenic
1009208506 6:60833301-60833323 CCTCCAGTGCAGTTGGTGCTTGG + Intergenic
1010922731 6:81704059-81704081 ATGGCAGTGCAGGTGAAGCTGGG - Intronic
1012096830 6:94972766-94972788 CTGCCAGTGCAGCTGGAAGAAGG - Intergenic
1012408187 6:98924843-98924865 CTGCCAGTGCAGGAGGAGGCGGG - Intronic
1013811943 6:114054765-114054787 CAGCCACTGCTGATTGAGCTAGG - Intergenic
1014530552 6:122553895-122553917 CTGTCAGGCCAGCTGGAGCTTGG + Intronic
1015312950 6:131784720-131784742 CTCCAAGTGTAGATGGAGGTTGG - Intergenic
1015917356 6:138231022-138231044 CTGCCCCTGCTGATGGAACTGGG + Intronic
1017710317 6:157161847-157161869 CTGTCACTGTAGATGTAGCTGGG - Intronic
1019509572 7:1411057-1411079 CTCCTAGAGCAGATGGAGCTCGG + Intergenic
1019742537 7:2682039-2682061 CAGCCAGAGCGGCTGGAGCTGGG - Intronic
1019745632 7:2699162-2699184 CTGCCAGGGCGGATGGAGAGTGG - Intronic
1021657799 7:22889566-22889588 CTGCCAGAGCATATTGTGCTGGG - Intergenic
1022100110 7:27164475-27164497 CAGCCAGGGCAGCCGGAGCTGGG - Intronic
1024512601 7:50215401-50215423 CAGCCAGTGCAGAGCAAGCTTGG - Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1026428060 7:70316371-70316393 CAGCCATTGCTGATGGAGCCAGG + Intronic
1028338793 7:89692536-89692558 CTGGCAGGGCAGCTGGAGCCTGG + Intergenic
1028649795 7:93138765-93138787 ACTCCAGGGCAGATGGAGCTTGG + Intronic
1031008280 7:116499047-116499069 CTGCAAGTGCATGTGGAGTTGGG - Intronic
1032787770 7:135214122-135214144 GTGTCAGGGCAGATGGAGGTGGG - Intergenic
1032943679 7:136825193-136825215 CTGCCACTGCACTTGGAGATTGG + Intergenic
1034316976 7:150142159-150142181 CTGCAAGTGTAGCTGGGGCTAGG + Intergenic
1034789889 7:153958525-153958547 CTGCAAGTGTAGCTGGGGCTAGG - Intronic
1034844247 7:154429854-154429876 CAGACATTTCAGATGGAGCTGGG + Intronic
1034969625 7:155410943-155410965 CTGCCTGTGAAGATGGAGGAAGG - Intergenic
1035047516 7:155978478-155978500 CTCCCAGTGCACAGGGGGCTTGG - Intergenic
1035056790 7:156041211-156041233 CTGCCTGTGCACCTGGAGCCAGG + Intergenic
1035451345 7:158979129-158979151 CTACAGCTGCAGATGGAGCTGGG + Intergenic
1035593141 8:833480-833502 CTGGCTTTGCAGATGGAGGTGGG - Intergenic
1036711599 8:11082991-11083013 CTGCCTGTGCAGAAAGGGCTGGG - Intronic
1037096169 8:14990397-14990419 CTGAAAGTACAGATGCAGCTTGG - Intronic
1039532452 8:38275754-38275776 CTTCCAGTGCAGAGGGAACCAGG + Exonic
1043888983 8:85635256-85635278 GTGGCAGTGCAGATGGGGATCGG + Intergenic
1044819667 8:96147121-96147143 CTACCAGTCCAGATGTAGCCCGG + Intronic
1045675847 8:104607482-104607504 CTGCCACAGCTGATGCAGCTGGG - Intronic
1046489799 8:114936658-114936680 CTGCCCTTGAAGATGGAGCAAGG + Intergenic
1049002236 8:139833449-139833471 TTGCCAGAGCAGAAGAAGCTGGG - Intronic
1049756751 8:144314202-144314224 CTGCCGGTGCTGTTTGAGCTGGG + Exonic
1049813128 8:144585216-144585238 CTGCCATTGCATCTGGAGCTGGG - Intronic
1050668903 9:7974018-7974040 CAGCCAGTGTAGATACAGCTAGG + Intergenic
1050941879 9:11471215-11471237 CTGCCAGGGCAACTGGAACTGGG + Intergenic
1052864179 9:33454983-33455005 CTGCCAGTGAGGATGGAGATAGG - Intergenic
1053277887 9:36797138-36797160 CTGCCAGTTCACACGCAGCTGGG + Intergenic
1054928622 9:70613681-70613703 CTGCCTGTGGAGAAGAAGCTTGG + Intronic
1056452937 9:86734246-86734268 CTGCCAGTGCAGCTAGAACAGGG - Intergenic
1056749906 9:89341380-89341402 CTTCCAGTGCAGTTGGACTTGGG + Exonic
1057455186 9:95202267-95202289 ATGCCAGGGCAGAGGGAACTGGG + Intronic
1057624768 9:96667470-96667492 CAGCCAAGGCAGCTGGAGCTGGG + Intergenic
1057631276 9:96720746-96720768 CTGCCAGTGCAGGAGGAGCTAGG - Intergenic
1057735508 9:97655735-97655757 CTTCCAGTTCCGTTGGAGCTGGG + Exonic
1057736307 9:97664752-97664774 CAGCTAGTCCAGATGGAACTCGG + Intronic
1062579740 9:137223927-137223949 GCGCCGGTGCAGATGGAGCCTGG + Intergenic
1186909659 X:14149211-14149233 ATGCCAGTTCAGATGTAGATGGG + Intergenic
1187361127 X:18628581-18628603 CTGCCAGGTCAGATGGATCCTGG + Exonic
1189846301 X:45141797-45141819 CTGCCAGTGCAGGTGAAGATGGG + Intergenic
1194457711 X:94124621-94124643 CTGCCAGTGCCGGTGGATGTGGG + Intergenic
1195876011 X:109541324-109541346 TTTCCAGTGGAGATGGAGCAAGG + Intronic
1197907695 X:131443742-131443764 GTTTCAGTGCAGATGGAGTTAGG - Intergenic
1199981434 X:152922713-152922735 TTGCCAGTGCGGATGGAGGCAGG + Exonic