ID: 1160727554

View in Genome Browser
Species Human (GRCh38)
Location 19:624262-624284
Sequence ACTCATCCACAGATGGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 261}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160727547_1160727554 3 Left 1160727547 19:624236-624258 CCATTTCTATGGAATGTCCAGAG 0: 1
1: 7
2: 85
3: 656
4: 1642
Right 1160727554 19:624262-624284 ACTCATCCACAGATGGGGAGGGG 0: 1
1: 0
2: 1
3: 23
4: 261
1160727546_1160727554 4 Left 1160727546 19:624235-624257 CCCATTTCTATGGAATGTCCAGA 0: 1
1: 9
2: 56
3: 160
4: 362
Right 1160727554 19:624262-624284 ACTCATCCACAGATGGGGAGGGG 0: 1
1: 0
2: 1
3: 23
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160727554 Original CRISPR ACTCATCCACAGATGGGGAG GGG Intronic
901210717 1:7524546-7524568 GCTCTTCCACAGATGAGGAATGG - Intronic
901512511 1:9724536-9724558 ACCCATCAACAGTTGGGGTGAGG - Intronic
903125119 1:21242537-21242559 ACTCTGTCACAGTTGGGGAGTGG + Intronic
903620656 1:24695807-24695829 ACCCAGCAACAGCTGGGGAGAGG + Intergenic
904774651 1:32899331-32899353 GCTCTACCACAGATGAGGAGAGG - Intronic
905644261 1:39613869-39613891 ATCCATGCACAGATGAGGAGAGG + Intergenic
906745713 1:48220985-48221007 ACTCTTCCAGAGATGGGAAAAGG - Intergenic
911268297 1:95770152-95770174 ACTTCTCTACAGATGGAGAGTGG - Intergenic
912389783 1:109295044-109295066 ACTCTTCCACCGGTGGAGAGAGG + Intronic
912540243 1:110409399-110409421 AATGATCCACAGAGGGGGTGAGG - Intergenic
913539171 1:119802500-119802522 TCTCAGCCACATATGGGGAGTGG - Intronic
913959474 1:143327671-143327693 ACCCTTTCACAGCTGGGGAGTGG - Intergenic
913972432 1:143424610-143424632 ACCCTTTCACAGCTGGGGAGTGG + Intergenic
914053833 1:144153244-144153266 ACCCTTTCACAGCTGGGGAGTGG - Intergenic
914066814 1:144250223-144250245 ACCCTTTCACAGCTGGGGAGTGG + Intergenic
914112339 1:144716131-144716153 ACCCTTTCACAGCTGGGGAGTGG - Intergenic
914125313 1:144813121-144813143 ACCCTTTCACAGCTGGGGAGTGG + Intergenic
916043578 1:160981800-160981822 ACTCTCCCAGAGATGGGAAGTGG + Intergenic
916531220 1:165658572-165658594 GCTCAGCCACACATGGGTAGGGG - Intronic
1064269492 10:13852111-13852133 ATTTTTCCACAGATGGGGTGTGG - Intronic
1064565306 10:16633438-16633460 ACCCATCCCCACCTGGGGAGAGG + Intronic
1064744021 10:18461547-18461569 ATTTTTCCACAGGTGGGGAGGGG + Intronic
1065680933 10:28231829-28231851 ACTCTTCCACAGAAGAGGAAAGG + Intronic
1067797616 10:49332130-49332152 ACTCTTCCACAGAAGGGAGGAGG + Intergenic
1068583972 10:58775666-58775688 AATAATGCACAGTTGGGGAGAGG + Intronic
1069896470 10:71683249-71683271 TGTCTCCCACAGATGGGGAGGGG - Intronic
1070698248 10:78579044-78579066 ACTTGTCCACAGATGCAGAGAGG - Intergenic
1071323992 10:84493718-84493740 ACTTTTCCACAGATGGGGAGAGG + Intronic
1072056050 10:91756957-91756979 ATTTTTCCACAGATGGGGATGGG + Intergenic
1072424536 10:95318799-95318821 ATTTTTCCACAGATGGGGTGGGG + Intronic
1074670509 10:115785125-115785147 ACATATCCACCGATGGAGAGGGG - Intronic
1074980974 10:118619784-118619806 ACCCACCCAGAGATGGGAAGTGG - Intergenic
1075687342 10:124373522-124373544 ACTCATTCAGGGATGGGGATGGG + Intergenic
1076530347 10:131140695-131140717 ACTCATCCACAGGCAGGCAGCGG + Intronic
1078188739 11:9074455-9074477 CCCCATCCACAGCTGGGCAGAGG + Intronic
1082072071 11:47947225-47947247 ATTCATCCACCGATGGTGTGCGG - Intergenic
1083244016 11:61411704-61411726 ACTCTTCCAGGGATAGGGAGTGG - Intronic
1083276443 11:61599694-61599716 GCCCATCTACAGACGGGGAGGGG + Intergenic
1083467519 11:62858533-62858555 AAACATCCACAGGTGTGGAGGGG - Intronic
1084784739 11:71435636-71435658 ACACATCCGCCGATGGGCAGAGG - Exonic
1084791836 11:71479982-71480004 ACTCTTCCACTGATGGGCATCGG + Intronic
1085651841 11:78275225-78275247 ACCCAGCCAAGGATGGGGAGTGG + Intronic
1088566804 11:111181174-111181196 ATCCATGCACAGATGAGGAGAGG - Intergenic
1089666602 11:120024397-120024419 ACTCAGGCACAGAGGGTGAGTGG - Intergenic
1091295006 11:134467529-134467551 GTTCATGCACAGATGAGGAGAGG - Intergenic
1091833417 12:3567117-3567139 GTTGATCCACAGATGGAGAGGGG - Intronic
1092123964 12:6063075-6063097 ACTCAGGCAGAGGTGGGGAGAGG + Intronic
1092276238 12:7062949-7062971 ACTCTTCCACAATTGGAGAGTGG - Exonic
1092455171 12:8636572-8636594 AAACACCCACAGATGTGGAGGGG + Intergenic
1092554554 12:9543196-9543218 ATTTTTCCACAGATGGGGTGGGG + Intergenic
1094517545 12:31147439-31147461 ATTTTTCCACAGATGGGGTGGGG - Intergenic
1096561279 12:52437703-52437725 CCTCTTCCACAGATGAGGAGTGG + Intergenic
1097059980 12:56275620-56275642 ACTCATCCACAGAGCTGGAGAGG + Intronic
1099005809 12:77233353-77233375 ATTCATCCACCCATGGGGGGTGG + Intergenic
1101799073 12:108004782-108004804 ACACATCTACAGAGAGGGAGAGG + Intergenic
1104573947 12:129949535-129949557 TCTCATCCATAGAAGGGAAGCGG - Intergenic
1106474310 13:30084301-30084323 ATTTTTCCACAGATGGGGTGGGG - Intergenic
1110560521 13:76906781-76906803 ACTCCTTCCCAGTTGGGGAGGGG - Intergenic
1113626694 13:111853110-111853132 ATTTCTCCACAGATGGGGGGTGG - Intergenic
1113905136 13:113815791-113815813 ACCCAGCCACAGAGAGGGAGAGG + Exonic
1113991217 14:16029568-16029590 ACTCAGGCAGAGATGGGGAGAGG - Intergenic
1116303177 14:43212583-43212605 ACTGATCCAGTGATGGGAAGAGG - Intergenic
1120827265 14:88967303-88967325 AATCCTCCACAGGTGAGGAGAGG - Intergenic
1120988534 14:90354964-90354986 ATTTTTCCACGGATGGGGAGGGG + Intergenic
1122426060 14:101606227-101606249 GCTCATCCACAGATGGGACATGG + Intergenic
1122847904 14:104510772-104510794 AGTCAGGGACAGATGGGGAGAGG + Intronic
1123423282 15:20148422-20148444 ACCCTTTCACAGCTGGGGAGTGG - Intergenic
1123532503 15:21154943-21154965 ACCCTTTCACAGCTGGGGAGTGG - Intergenic
1124443487 15:29707449-29707471 GCACATCCACAGATGGTCAGGGG - Intronic
1126330449 15:47525563-47525585 ACTCATCCACAAATAGGAATGGG + Intronic
1127815699 15:62607025-62607047 ACTCATCCGGAGATGAGGAAGGG - Intronic
1128117078 15:65115508-65115530 ATTCATTCATTGATGGGGAGGGG - Intergenic
1129671711 15:77611303-77611325 ACTCTTACACAGATGCAGAGGGG - Intergenic
1135946231 16:26867409-26867431 TCTCATCCCCAGCTGGGAAGAGG + Intergenic
1136861536 16:33707180-33707202 ACCCTTTCACAGCTGGGGAGTGG + Intergenic
1136910399 16:34140692-34140714 ACTCAGGCAGAGATGGGGAGAGG - Intergenic
1136932550 16:34432307-34432329 ACACAGCCACAGAGGGAGAGAGG - Intergenic
1136972022 16:34979507-34979529 ACACAGCCACAGAGGGAGAGAGG + Intergenic
1137366452 16:47863649-47863671 ATTTCTACACAGATGGGGAGTGG + Intergenic
1138925395 16:61584021-61584043 ACTGATCCAAAGATGGTGACTGG + Intergenic
1139478053 16:67213011-67213033 ACTCATTCCCAGGTGTGGAGAGG + Intronic
1139722606 16:68868859-68868881 CCTCTTCCACACATGGTGAGAGG - Intronic
1139808462 16:69590782-69590804 ACTCTACCCCAGATGGGGCGGGG - Intronic
1141134791 16:81458222-81458244 ACCCATCCACGGCTGGGCAGTGG + Intronic
1141218178 16:82044436-82044458 CCTCACCCACAGATGGGGCCTGG + Intronic
1203123036 16_KI270728v1_random:1555371-1555393 ACCCTTTCACAGCTGGGGAGTGG + Intergenic
1142680140 17:1542675-1542697 ACAGATGCACAGATGGGGAAGGG + Intronic
1142736562 17:1904165-1904187 ACTCATCAACAGCTAAGGAGAGG - Intergenic
1143565068 17:7716220-7716242 GCACAGCCACAGTTGGGGAGGGG + Intergenic
1144165894 17:12610034-12610056 ATTCATTCAAAGATGGGAAGTGG + Intergenic
1144829791 17:18124814-18124836 TCTCATCCACAAAATGGGAGTGG + Intronic
1147951116 17:44108607-44108629 ACCGATCAAGAGATGGGGAGAGG + Intronic
1147988527 17:44319953-44319975 TCTCTCCCACGGATGGGGAGAGG - Exonic
1148219579 17:45852024-45852046 TCTCATCCACAGATGAGGAAAGG + Intergenic
1148353482 17:46958098-46958120 AGTCCTGCACAAATGGGGAGAGG - Intronic
1148791680 17:50176749-50176771 GCTCCTCCAGAGATGGGCAGGGG + Intergenic
1148949040 17:51292737-51292759 ATTCATCCACAAATTGGGTGAGG + Intronic
1150187072 17:63194013-63194035 CCTCATCTACAGATGGAGGGGGG - Exonic
1151074586 17:71256456-71256478 ATTAATCCACTAATGGGGAGGGG - Intergenic
1153509658 18:5838109-5838131 ACTCATCAACCTCTGGGGAGGGG + Intergenic
1153693321 18:7615685-7615707 ATTTTTCCACAGATGGGGTGGGG + Intronic
1154228982 18:12536562-12536584 CCTCATCAGTAGATGGGGAGTGG + Intronic
1158862893 18:61610378-61610400 ACTTTTCCACAGACGCGGAGGGG + Intergenic
1159719453 18:71869302-71869324 ACTGATACACAGATGGAAAGGGG - Intergenic
1159902603 18:74061535-74061557 TCACATCCACAGATGGGGACAGG + Intergenic
1160593823 18:79961026-79961048 AAACATCCACAGGTGTGGAGGGG + Intergenic
1160727554 19:624262-624284 ACTCATCCACAGATGGGGAGGGG + Intronic
1163607972 19:18286137-18286159 TCTCCTCCATAGAAGGGGAGGGG + Intergenic
1165453520 19:35898481-35898503 CCTCATTCACAGATGGGGTCAGG + Exonic
1166366813 19:42281990-42282012 ACTCACTCACCGGTGGGGAGAGG + Intronic
1166822318 19:45588001-45588023 ACACAAGCAGAGATGGGGAGGGG + Intronic
1166985826 19:46659654-46659676 CCCCCTCCCCAGATGGGGAGTGG - Intronic
1167110654 19:47458678-47458700 ACACGTCCAGACATGGGGAGAGG - Intronic
1167818677 19:51906624-51906646 AAACACCCACAGATGTGGAGAGG + Intronic
1168269192 19:55240409-55240431 GCTCATCCAGAGACGGGGATGGG + Intronic
1202693309 1_KI270712v1_random:105902-105924 ACCCTTTCACAGCTGGGGAGTGG - Intergenic
926326948 2:11793191-11793213 TCTCACCCACAGATGGACAGTGG - Intronic
927728195 2:25444653-25444675 ACTTCTCCCTAGATGGGGAGCGG - Intronic
930029795 2:47051546-47051568 TCTCACCCACAGCTGGGGAGGGG - Intronic
930869954 2:56160294-56160316 CCCCATACAGAGATGGGGAGGGG - Intergenic
930878294 2:56244551-56244573 GCTTATCCACAGTAGGGGAGAGG - Intronic
932497042 2:72150832-72150854 CCTCATCCTCAGATAGGGTGTGG - Intergenic
933759129 2:85662175-85662197 AGTGATCCAGAGATGTGGAGAGG - Intronic
933953259 2:87348657-87348679 ACCCTTTCACAGCTGGGGAGTGG + Intergenic
934177125 2:89585548-89585570 ACCCTTTCACAGCTGGGGAGTGG + Intergenic
934237490 2:90245002-90245024 ACCCTTTCACAGCTGGGGAGTGG + Intergenic
934275700 2:91571663-91571685 ACCCTTTCACAGCTGGGGAGTGG - Intergenic
934287432 2:91659907-91659929 ACCCTTTCACAGCTGGGGAGTGG + Intergenic
934459916 2:94208308-94208330 ACCCTTTCACAGCTGGGGAGTGG + Intergenic
934614172 2:95761170-95761192 ACTCAGGGACAGCTGGGGAGGGG - Intergenic
934646738 2:96063358-96063380 ACTCAGGGACAGCTGGGGAGGGG + Intergenic
934840141 2:97619440-97619462 ACTCAGGGACAGCTGGGGAGGGG + Intergenic
935016272 2:99185214-99185236 ATTTTTCCACAGATAGGGAGGGG - Intronic
935141395 2:100355972-100355994 AGTCATCTTCTGATGGGGAGGGG - Intergenic
936176066 2:110221015-110221037 ATCCATGCACAGATGAGGAGAGG + Intergenic
936836995 2:116721211-116721233 ATCCATGCACAGATGGGGAGAGG - Intergenic
937122723 2:119451975-119451997 ACTGATCCCCAGCTAGGGAGAGG + Intronic
940658923 2:156522443-156522465 ACTGAACCACAGAATGGGAGAGG - Intronic
944526334 2:200623713-200623735 AGTCATGGACAGATGTGGAGGGG + Intronic
946300679 2:218822030-218822052 ACTGATGACCAGATGGGGAGGGG + Intergenic
946717994 2:222573396-222573418 ACTAATCCACACTTGGGGTGAGG + Intronic
946861717 2:224006285-224006307 AATTATCCACTGGTGGGGAGGGG + Intronic
947000875 2:225454776-225454798 CTTTTTCCACAGATGGGGAGGGG - Intronic
948224414 2:236298091-236298113 TCCCCTTCACAGATGGGGAGTGG - Intergenic
948614936 2:239192301-239192323 CCTCACCCACATATGGGGTGGGG - Intronic
1169109637 20:3023860-3023882 AAACATCCACAGGTGTGGAGGGG + Intronic
1169198022 20:3693687-3693709 GCACATTCACAGCTGGGGAGAGG + Exonic
1169322050 20:4640987-4641009 ACTTTTCCACAGATGGGTGGGGG - Intergenic
1169329285 20:4704101-4704123 TCTTAGCCCCAGATGGGGAGGGG - Intergenic
1171291095 20:23983572-23983594 AAACACCCACAGATGTGGAGGGG + Intergenic
1171433987 20:25104949-25104971 ACTAATCCTCAGTTGGGGAGTGG - Intergenic
1171784146 20:29448002-29448024 ACTCAGGCAGAGATGGGGAGAGG - Intergenic
1171813372 20:29762917-29762939 ACTCAGGCAGAGATGGGGAGAGG + Intergenic
1171905864 20:30899415-30899437 ACTCAGGCAGAGATGGGGAGAGG - Intergenic
1172053403 20:32137182-32137204 ACTGGTCCACAGATGGTAAGTGG - Intronic
1173583814 20:44166748-44166770 ATGCATCCACAGAGGGAGAGAGG + Intronic
1175102960 20:56593192-56593214 TCTCAACCACAGGTGGGGATGGG - Intergenic
1175632167 20:60550402-60550424 ACTCAGCCACAGTAGGGTAGAGG - Intergenic
1178421266 21:32445315-32445337 GCTTATCCACAGATGTGGAATGG - Intronic
1179469188 21:41599181-41599203 ACAGATCCCCAGATGGGGAAAGG + Intergenic
1179722687 21:43324559-43324581 ACAGAGGCACAGATGGGGAGAGG - Intergenic
1180000294 21:44992519-44992541 ACTCATGCATACATGAGGAGGGG - Intergenic
1180316051 22:11277956-11277978 ACTCAGGCAGAGATGGGGAGAGG + Intergenic
1180766314 22:18347521-18347543 AAACACCCACAGGTGGGGAGGGG - Intergenic
1180962716 22:19769419-19769441 ACTCATCTACAAAGGTGGAGGGG - Intronic
1181356290 22:22298191-22298213 ACCCTTTCACAGCTGGGGAGTGG - Intergenic
1181400864 22:22649363-22649385 AAACACCCACAGATGTGGAGGGG - Intergenic
1181646640 22:24234873-24234895 GCCCATGGACAGATGGGGAGGGG - Intronic
1181702846 22:24630461-24630483 AAACACCCACAGATGTGGAGGGG - Intergenic
1181941537 22:26481507-26481529 ACTCATTCAAACATTGGGAGAGG + Intronic
1183954179 22:41369257-41369279 GCTCATCCACAGTGAGGGAGGGG - Intronic
1184098060 22:42327266-42327288 AGACATCCCCAGGTGGGGAGAGG + Intronic
1184274672 22:43403657-43403679 GCTCATCCAGAGAAGGGCAGGGG + Intergenic
1184428115 22:44424988-44425010 ACTCACCCAGGGATGAGGAGGGG + Intergenic
1185227476 22:49661177-49661199 TGTCATCCACAGGTGAGGAGTGG - Intergenic
1185398230 22:50603426-50603448 GCTCCTCCACGGAAGGGGAGGGG - Exonic
949708272 3:6843342-6843364 ACTCCTTCACAGATGGGAACTGG - Intronic
950214011 3:11145089-11145111 AGTAATCCACAGATGGGGTATGG - Intronic
950408586 3:12819951-12819973 ACTTTCCCAGAGATGGGGAGGGG + Intronic
950924741 3:16729240-16729262 ACTAATTCACTGTTGGGGAGGGG - Intergenic
951372534 3:21867933-21867955 ACACAACCACATATGGGTAGTGG + Intronic
951551427 3:23878909-23878931 ATTTTTCCACAGATGGGGGGTGG - Intronic
952719761 3:36520366-36520388 ACTTATCCAAAGATAGGCAGTGG + Intronic
953843658 3:46409932-46409954 ACTCAGCCACAGAAAGGAAGTGG - Intronic
954223385 3:49167794-49167816 ACTCACCCACAGCTGGGGACTGG - Intergenic
956211526 3:66806647-66806669 ACTGCCCCACAGATGGGGAGTGG - Intergenic
959985200 3:112564095-112564117 AAACACCCACAGATGTGGAGGGG - Intronic
960214553 3:115015505-115015527 ACACATGGACACATGGGGAGGGG - Intronic
962857655 3:139363465-139363487 ATTTTTCCACAGATGGGAAGGGG - Intronic
963318788 3:143789777-143789799 CCTCATGGACAGATGGGTAGAGG + Intronic
968565743 4:1311771-1311793 TCTCATCCAGGGATGTGGAGTGG + Intronic
969585717 4:8090260-8090282 GCACATCCAGGGATGGGGAGGGG - Intronic
970469570 4:16363333-16363355 ACCCATCCAGAGATGGGTATTGG + Intergenic
971879476 4:32351559-32351581 AGTTTTCCACAGATGGGCAGAGG + Intergenic
972156996 4:36175717-36175739 ACTTATCAAAAGATGGAGAGGGG + Intronic
972658450 4:41089662-41089684 ACTCATTCACAGATAGCCAGTGG + Intronic
974501235 4:62706197-62706219 ACTCCTCCACCTCTGGGGAGGGG + Intergenic
975897478 4:79110508-79110530 ATCCATGCACAGATGAGGAGAGG + Intergenic
976348398 4:84031289-84031311 ACTCATCCAGGAATGGAGAGTGG - Intergenic
976875151 4:89845231-89845253 ACTTATCCAAAGATGAGTAGAGG + Intergenic
978359652 4:107916763-107916785 TCTCATCCAAAGGTTGGGAGAGG + Intergenic
978359657 4:107916796-107916818 TCTCATCCAAAGGTTGGGAGAGG + Intergenic
978359662 4:107916829-107916851 TCTCATCCAAAGGTTGGGAGAGG + Intergenic
978561389 4:110037415-110037437 ACTCATCCACAGTAGAAGAGAGG + Intergenic
986288015 5:6374901-6374923 GCTCCTCCACAGAGGAGGAGGGG - Intronic
989085708 5:37673807-37673829 ACACATGGACACATGGGGAGGGG - Intronic
989240296 5:39195533-39195555 ATACATACACAGATGAGGAGGGG + Intronic
991172665 5:63646599-63646621 ATTTTTCCACAGATGGGGTGGGG + Intergenic
993209486 5:84930073-84930095 ACTCATGCACATATGAGGATTGG + Intergenic
993913115 5:93708444-93708466 ATTTTTCCACACATGGGGAGTGG + Intronic
998510691 5:142711728-142711750 ATCCATGCACAGATGAGGAGAGG - Intergenic
999507866 5:152217128-152217150 ATTCATCCACGAATGGAGAGAGG - Intergenic
999671740 5:153964592-153964614 CCTCATCCACAGCTGGGCAAGGG + Intergenic
1000004938 5:157174946-157174968 ACCCATCCACAGATGGGGGAGGG - Intronic
1004720270 6:18262966-18262988 ACTCAGCCACACTTGGGAAGAGG - Intronic
1006919073 6:37615671-37615693 CCTCATCCTCACATGGGCAGTGG - Intergenic
1007138974 6:39552428-39552450 ACTCTTTCACAGATGGGAATAGG + Intronic
1007184681 6:39959158-39959180 ACTCATGCACAGAGTGGGTGTGG + Intergenic
1008840071 6:55892208-55892230 ATTCATCCACTGATGGGCACAGG - Intergenic
1009879188 6:69544084-69544106 ACTCATCCACAGGTGATGAAAGG + Intergenic
1010877149 6:81120763-81120785 ACTTTTCCACAGATGGGGTGTGG - Intergenic
1013532209 6:111030302-111030324 ACTCATCCACAGTGTGTGAGAGG - Intergenic
1015882538 6:137883521-137883543 ACTCTTCCTCTGATGGGAAGAGG + Intergenic
1016588191 6:145713610-145713632 ACTCATACACTGCTGGTGAGTGG + Intronic
1017260106 6:152376021-152376043 ATTTTTCCACAGATGGGGTGGGG + Intronic
1017628132 6:156369080-156369102 ACACATCCAGAGGTGGGGAGGGG - Intergenic
1019092987 6:169555356-169555378 GCTCATCCCCAGAGGAGGAGAGG + Intronic
1019570907 7:1711743-1711765 TGTCATCCACAGAGGGGCAGGGG - Intronic
1019710509 7:2516262-2516284 ACTCATCGGCTGATGGAGAGCGG - Intronic
1021012422 7:15486990-15487012 GCTCTTCCAGAGATGGTGAGAGG - Intronic
1023525521 7:41098571-41098593 ACCCCTTCACAGATGGTGAGTGG - Intergenic
1024404928 7:48968051-48968073 ATTCATGCACAGATGAGAAGAGG + Intergenic
1024644028 7:51356426-51356448 AGCCATCTAGAGATGGGGAGGGG - Intergenic
1026165768 7:67907926-67907948 ATTCATGCACAGCTGAGGAGAGG + Intergenic
1026463663 7:70635544-70635566 AGTCATACACAGAGAGGGAGAGG + Intronic
1029362751 7:100099271-100099293 ACTCATGCGCAGATTGTGAGTGG - Exonic
1029905856 7:104092970-104092992 ACATATACACAGATGGGGACAGG + Intergenic
1029995161 7:105000861-105000883 ACTCCACCACAGAGTGGGAGAGG + Intergenic
1030074544 7:105725093-105725115 TCACATCCACAGGTAGGGAGTGG + Intronic
1030222459 7:107110931-107110953 GCTCAGCCACAGAGGGGTAGAGG + Intronic
1030331002 7:108270396-108270418 AATAATTCACAGATAGGGAGAGG + Intronic
1030874490 7:114796048-114796070 ACTCAGCTATAGATGAGGAGGGG - Intergenic
1032073395 7:128823833-128823855 ATTTTTCCACAGATGGAGAGGGG + Intergenic
1033482527 7:141756120-141756142 CCCCATCCACAGGTGTGGAGGGG - Intronic
1033876986 7:145833481-145833503 ACTCATCCTCTGATGGGTTGTGG + Intergenic
1033929978 7:146508863-146508885 ACTCATACACATATGTGGATTGG - Intronic
1035329425 7:158086382-158086404 ACTCAGCCACAAAGGGGGAATGG + Intronic
1035543829 8:463487-463509 ACTTGTCCTCAGATGGGCAGAGG - Intronic
1035807839 8:2468638-2468660 ACTCATACACGGTGGGGGAGGGG + Intergenic
1036080036 8:5545133-5545155 ACAGAGGCACAGATGGGGAGTGG - Intergenic
1036353459 8:8026984-8027006 AATCACCCACAGGTGTGGAGGGG + Intergenic
1037131582 8:15413262-15413284 ACGGGTCCACAGATGGAGAGAGG - Intergenic
1037391574 8:18398357-18398379 ATTCATACACAGAAAGGGAGAGG + Intronic
1038781907 8:30575387-30575409 GCTCTTCAGCAGATGGGGAGGGG - Intergenic
1039594453 8:38778749-38778771 ACTTTTTCCCAGATGGGGAGAGG + Intronic
1039831683 8:41220437-41220459 TGTCATCCACAGATGGGTAAAGG + Intergenic
1041008192 8:53515984-53516006 AGTCATCCACAGATCAGGAGAGG - Intergenic
1041483130 8:58345150-58345172 AATTTTCCACAGATGGGGTGGGG + Intergenic
1044625996 8:94235376-94235398 CCCAACCCACAGATGGGGAGTGG - Intergenic
1047745278 8:127840269-127840291 ACTCATCCTGAGAAAGGGAGAGG - Intergenic
1048938039 8:139373252-139373274 ACTCCTCCTCCTATGGGGAGGGG - Intergenic
1052764904 9:32631190-32631212 ACTCTTCCCGAGATGGGTAGAGG + Exonic
1053690418 9:40584116-40584138 ACCCTTTCACAGCTGGGGAGTGG + Intergenic
1054301670 9:63385077-63385099 ACCCTTTCACAGCTGGGGAGTGG + Intergenic
1055965561 9:81862030-81862052 ACTCTGCCACAGATGGGGGTGGG + Intergenic
1056445266 9:86659571-86659593 GCTCAACCACAGAGGGGGACAGG - Intergenic
1056601395 9:88049956-88049978 ACACAGCCATAGATGGGGTGGGG - Intergenic
1057394687 9:94669335-94669357 AAACTTGCACAGATGGGGAGGGG + Intergenic
1057597134 9:96424087-96424109 ACCTTTCCACAGATGGAGAGAGG - Intergenic
1060046390 9:120344614-120344636 GCCCATCCAGAGATGGGGAGTGG + Intergenic
1062659491 9:137621660-137621682 ACTAATCCACAAATGGGGAATGG - Intronic
1203364348 Un_KI270442v1:243909-243931 ACTCAGGCAGAGATGGGGAGAGG + Intergenic
1203621115 Un_KI270749v1:130385-130407 ACCCTTTCACAGCTGGGGAGTGG + Intergenic
1185559944 X:1052249-1052271 ATTCATTCACAGATGGGTATTGG - Intergenic
1185787322 X:2901868-2901890 TCACATTCACAGATGGAGAGGGG - Intergenic
1186044220 X:5516889-5516911 ATTCATCAAGAGATGAGGAGTGG - Intergenic
1189327183 X:40120030-40120052 ACTGCTCCACAGTTGGGGCGGGG + Intronic
1189622224 X:42854013-42854035 ATTAACCCACAGATGGGGAAGGG + Intergenic
1192379333 X:70599372-70599394 ACTCATACTCAGAAGGGTAGAGG + Intronic
1192472101 X:71408081-71408103 ACTCTTCCCGAGATGGGTAGAGG - Exonic
1193308352 X:79975819-79975841 CTTCATGCACAGATTGGGAGGGG - Intergenic
1194292120 X:92087021-92087043 GTTCATGCACAGATGAGGAGAGG + Intronic
1198028018 X:132728035-132728057 ATTCATCCACTGATGGGCATTGG + Intronic
1200752391 Y:6958415-6958437 AAACACCCACAGATGTGGAGAGG - Intronic
1200827796 Y:7661138-7661160 ACTCAGCCACAGCTGGGCATGGG + Intergenic
1202584515 Y:26409230-26409252 ACCCTTTCACAGCTGGGGAGTGG - Intergenic