ID: 1160727785

View in Genome Browser
Species Human (GRCh38)
Location 19:625176-625198
Sequence TCCGGACCTGCTGTCCTATG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 59}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160727785_1160727791 29 Left 1160727785 19:625176-625198 CCGCATAGGACAGCAGGTCCGGA 0: 1
1: 1
2: 0
3: 9
4: 59
Right 1160727791 19:625228-625250 CACATATACCAGCTCCTTGAAGG 0: 1
1: 1
2: 0
3: 8
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160727785 Original CRISPR TCCGGACCTGCTGTCCTATG CGG (reversed) Exonic
900576376 1:3384428-3384450 ACCTGACCTGCTGTCCACTGTGG - Intronic
901825512 1:11858630-11858652 TCCTCACCTGCTGTCCCAAGAGG - Intronic
906979062 1:50608573-50608595 AGGGGACCTGCTGTCCTAGGAGG + Intronic
909329528 1:74395313-74395335 TCAGGACCTGGTGGCCTATATGG + Intronic
914432043 1:147627583-147627605 TGAGTACCTGCTCTCCTATGTGG - Intergenic
917224264 1:172764864-172764886 TTCTGACCAGCTGGCCTATGTGG + Intergenic
922841835 1:228648418-228648440 TCCGGACTTGGTGTGCTCTGAGG + Intergenic
1063417895 10:5889186-5889208 TCGGGACGTGCTGGCCTATCTGG - Exonic
1067738013 10:48873741-48873763 TCAGGAGCTGCTTTCCTATCAGG - Intronic
1070048387 10:72862379-72862401 TTGGGAACTGCTGTCCTATGGGG - Intronic
1075934801 10:126331241-126331263 TCTGGACTTGCTCTCCTATGAGG + Intronic
1078206621 11:9235455-9235477 TCGGGACCAGCTGGCCAATGTGG + Intronic
1087060590 11:93973208-93973230 TTGGGAACTGCTGTTCTATGGGG + Intergenic
1088150698 11:106741356-106741378 TCCAGAGCTGCTGTCCAATATGG - Intronic
1091242444 11:134062907-134062929 TCGGGGCCTGCTGTACTAAGGGG + Intergenic
1101292919 12:103389382-103389404 TCAGGATCTGCTCTCCTCTGAGG + Intronic
1107377405 13:39818991-39819013 TTTGTAACTGCTGTCCTATGTGG + Intergenic
1109117566 13:58407904-58407926 TCAGGCCCTGATGTCCTCTGAGG - Intergenic
1120848137 14:89144303-89144325 TCCGGACACTCTGTCCTCTGGGG + Intronic
1129295099 15:74595927-74595949 TCAGGTCCTGCTGTACTCTGGGG + Exonic
1136287323 16:29252256-29252278 TCAGGATCTGCTGTGCTCTGGGG + Intergenic
1141698663 16:85632554-85632576 TCCGAGCCTGCTGTCCCATGGGG + Intronic
1142092936 16:88224885-88224907 TCAGGATCTGCTGTGCTCTGGGG + Intergenic
1143110492 17:4550155-4550177 TCCGGCCCTGCAGGGCTATGTGG - Exonic
1147489074 17:40847009-40847031 TCTGGACCTGCAGGGCTATGAGG + Intergenic
1147968948 17:44209498-44209520 CCAGGAGCTGCTGTCCAATGGGG - Exonic
1150069592 17:62139762-62139784 CCCGGACCTGCTGTCCTATGCGG - Intergenic
1150463700 17:65373697-65373719 TCAGGACCTGCTTTCCTTCGGGG - Intergenic
1160516005 18:79479691-79479713 GCCTGACCCGCTGGCCTATGAGG - Intronic
1160727785 19:625176-625198 TCCGGACCTGCTGTCCTATGCGG - Exonic
1162919983 19:13895306-13895328 TGCTGAGCTGCTGTGCTATGTGG + Intronic
1163440587 19:17320695-17320717 GCCGGTCTTGCTGTCCTAGGTGG + Exonic
1168693981 19:58394878-58394900 TCCTGACCTGTTGGCCTGTGGGG + Intergenic
925149454 2:1605263-1605285 TCCCCACCTGCTGTCCTGTGTGG - Intergenic
935112494 2:100105402-100105424 CCCGGACCTGCTCTCCGTTGCGG + Intronic
938066937 2:128286392-128286414 TCCTGACCTGCAGTCTGATGAGG - Intronic
941758462 2:169214291-169214313 TCCTGTCTTGCTGTCCTCTGTGG - Intronic
942758606 2:179371239-179371261 TCCTAATCTGCTTTCCTATGTGG - Intergenic
946403073 2:219478964-219478986 TCCCCACCTCCTGTCCTCTGAGG - Intronic
948761150 2:240191815-240191837 TCTGCACCTGTTGTCCTTTGAGG + Intergenic
1170387553 20:15836048-15836070 TCAGGACCTGGGGTCCCATGTGG - Intronic
1179998172 21:44983576-44983598 CCAGGGCCTTCTGTCCTATGTGG - Intergenic
1183764803 22:39862964-39862986 TTCGGACCTTCTGTCACATGAGG + Intronic
953752335 3:45618358-45618380 AAGGGCCCTGCTGTCCTATGGGG + Intronic
954103987 3:48399249-48399271 TGAGGACCTGCTGTCCTGGGAGG - Intronic
969254694 4:5994042-5994064 TGCCAACCTGCTGGCCTATGAGG + Intergenic
985604966 5:853556-853578 CCCGGGCTTGCTGTCCTCTGTGG - Intronic
990176046 5:53109731-53109753 TTCGGTCCCGCTGTCCTAGGCGG - Exonic
1008329858 6:50231940-50231962 CCCATAGCTGCTGTCCTATGGGG - Intergenic
1017764771 6:157597654-157597676 CCCAGCCCTGCTGTCCTGTGTGG + Intronic
1018944033 6:168333216-168333238 TCCGGACTTGCTGCCCCCTGTGG - Intergenic
1018975009 6:168557982-168558004 TCCAGAGCTGCTGGCCTCTGGGG + Intronic
1021954781 7:25813400-25813422 TCAGGACCTGCAGGCCTATGAGG - Intergenic
1022616600 7:31937332-31937354 TCAGGACCTGCTGTGTTATGTGG + Intronic
1023132483 7:37016591-37016613 TCATGACCTGCAGTCCAATGTGG + Intronic
1026373878 7:69730471-69730493 TCCTTACCTGCTGTGCTATGAGG + Intronic
1034263049 7:149769004-149769026 TCCGGAGCTGCTATCTCATGAGG - Intronic
1034721520 7:153298497-153298519 TCCAGACCTGGTGTCCTGTAAGG + Intergenic
1035578576 8:725206-725228 TCCGTGCCTGCTGTCCTCTCCGG + Intronic
1037727492 8:21495232-21495254 TACAGACCTACTGTGCTATGAGG - Intergenic
1042866967 8:73365162-73365184 TCCTGACTTACTGTCCTATAAGG + Intergenic
1044207286 8:89505441-89505463 TCCTGACCTGCTCTCTAATGGGG - Intergenic
1048458544 8:134600986-134601008 TCCAGACCTGCTGTCCCAGGAGG - Intronic
1048987666 8:139743724-139743746 ACCGGGCCAGCTGTCCTGTGGGG + Intronic
1049299715 8:141863062-141863084 TCGGGCCCTGCTGCCCTAAGTGG - Intergenic
1053348216 9:37393808-37393830 ACCGGACGTGCTGACCTCTGTGG + Intergenic
1060828790 9:126701132-126701154 TCCGGACCTGCTGTCCCTGGTGG - Intergenic
1189134215 X:38532428-38532450 CCAGGAGCTGCTGTCCAATGGGG - Intronic
1194496588 X:94623790-94623812 TCCTGGCCTGCTGTCCTTGGTGG - Intergenic
1202593044 Y:26507636-26507658 TCCGTCCCTGCTGTCCTTTCCGG - Intergenic