ID: 1160727994

View in Genome Browser
Species Human (GRCh38)
Location 19:626448-626470
Sequence ATATTTAAGCTATACATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160727994_1160728000 18 Left 1160727994 19:626448-626470 CCAGCCATGTATAGCTTAAATAT 0: 1
1: 0
2: 0
3: 8
4: 170
Right 1160728000 19:626489-626511 TTTTCATTTAATTTTTGGCCAGG 0: 1
1: 0
2: 7
3: 102
4: 993
1160727994_1160728001 26 Left 1160727994 19:626448-626470 CCAGCCATGTATAGCTTAAATAT 0: 1
1: 0
2: 0
3: 8
4: 170
Right 1160728001 19:626497-626519 TAATTTTTGGCCAGGCACAGTGG 0: 7
1: 88
2: 752
3: 3763
4: 13149
1160727994_1160727999 13 Left 1160727994 19:626448-626470 CCAGCCATGTATAGCTTAAATAT 0: 1
1: 0
2: 0
3: 8
4: 170
Right 1160727999 19:626484-626506 TTTTTTTTTCATTTAATTTTTGG 0: 1
1: 8
2: 209
3: 1891
4: 26921

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160727994 Original CRISPR ATATTTAAGCTATACATGGC TGG (reversed) Intronic
901518152 1:9763256-9763278 ATATTTAAGGTATCCTAGGCCGG - Intronic
903557271 1:24203020-24203042 ATATTGAGGCTATAGAGGGCTGG - Intergenic
903584103 1:24395726-24395748 ATATTTAAATTATTCAAGGCTGG - Intronic
906052942 1:42889460-42889482 AAATTTTAGCTATTCTTGGCTGG - Intergenic
908493187 1:64667105-64667127 ATATTTAAGCTACAGATGTCAGG + Intronic
908609877 1:65845962-65845984 ATCTTTAAGCTGTGCCTGGCTGG + Intronic
908815441 1:68027971-68027993 TTATTCCAGCTATACATGGTTGG + Intergenic
909954792 1:81766532-81766554 ATATGTAAGAAATACAGGGCTGG + Intronic
909987592 1:82181716-82181738 ATATAAAAAATATACATGGCTGG - Intergenic
910487151 1:87727823-87727845 ATCTTTAAGGTACACATGGTAGG + Intergenic
911215730 1:95190886-95190908 ATATTTAAAATATACATGTATGG - Intronic
911782304 1:101897392-101897414 ATGGTTAAGTTTTACATGGCAGG + Intronic
912149234 1:106836724-106836746 ATATATAACCTATATATGGTGGG + Intergenic
916639726 1:166714676-166714698 ATATTTAAACTAGACCAGGCTGG + Intergenic
916655064 1:166867933-166867955 ATGTTTTATCTATAAATGGCTGG - Intronic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
1063309060 10:4935867-4935889 ATTTTTAAGGTGGACATGGCAGG + Intronic
1063453136 10:6164418-6164440 ATGTTTAACCCAGACATGGCAGG + Intronic
1063468570 10:6265502-6265524 ATGTTTAGGCTATACATCCCTGG + Intergenic
1065939827 10:30554223-30554245 ACATTTCAGCTATACCTAGCCGG - Intergenic
1066598079 10:37074834-37074856 TTATTTAAGCTAATCTTGGCAGG - Intergenic
1074735108 10:116422961-116422983 ATATTTAAATTTTACATGACAGG - Intergenic
1075448808 10:122532962-122532984 ATTTTTATGCTATACATTACTGG + Intergenic
1079660941 11:23035748-23035770 ATACTTAAGCCATTCATGGACGG + Intergenic
1081589775 11:44413612-44413634 GTATATAAGTTATACATAGCGGG + Intergenic
1086556313 11:88115542-88115564 ATAATTAGGCTATACTTGTCTGG - Intronic
1088030707 11:105245986-105246008 CTATCTAAACTATACATGGTTGG - Intergenic
1095428770 12:42110134-42110156 ATATTAAAGCTATGCATTGATGG - Intronic
1095575910 12:43738959-43738981 ATATTTAATATTTAAATGGCTGG + Intronic
1098362538 12:69668737-69668759 ATATTTTGACTATTCATGGCTGG - Intronic
1098709296 12:73734789-73734811 ATATTTAAACTAAAAATGGAAGG + Intergenic
1099821758 12:87720132-87720154 AACTTTAAGCTATGTATGGCTGG + Intergenic
1104319546 12:127737658-127737680 AATGTTAAGCTTTACATGGCTGG - Intergenic
1105427196 13:20304090-20304112 ATTTTTAATCTACACATGCCAGG + Intergenic
1106949957 13:34872295-34872317 GTAGTTCAGATATACATGGCTGG + Intergenic
1107842636 13:44474919-44474941 ATATCTAAGATATAAATTGCAGG - Intronic
1114006001 14:18313850-18313872 ATAGTTAAGCTGTAAATGGAAGG + Intergenic
1116729167 14:48600014-48600036 ATAGTTATCTTATACATGGCAGG + Intergenic
1118419571 14:65586365-65586387 CTATTGAATCTATACTTGGCTGG - Intronic
1119284653 14:73443161-73443183 GTATTTAAGGTAAACAGGGCTGG - Intronic
1123499899 15:20870884-20870906 AAATTTGAGCTATACATTGTTGG + Intergenic
1123557149 15:21444581-21444603 AAATTTGAGCTATACATTGTTGG + Intergenic
1123593372 15:21881850-21881872 AAATTTGAGCTATACATTGTTGG + Intergenic
1124697646 15:31878828-31878850 ATAATTAAGATATTAATGGCTGG - Intergenic
1125092583 15:35811760-35811782 ATATTGAAGATTTACTTGGCAGG + Intergenic
1125185289 15:36922968-36922990 ATATTAAAGACTTACATGGCAGG - Intronic
1126412761 15:48388896-48388918 GTATTGAAGTTATACTTGGCTGG + Intergenic
1202965493 15_KI270727v1_random:171769-171791 AAATTTGAGCTATACATTGTTGG + Intergenic
1138975697 16:62205002-62205024 ACATTTAAGTTGTAAATGGCAGG - Intergenic
1139090179 16:63636059-63636081 TTATTTTAGGTATACAAGGCCGG + Intergenic
1146913349 17:36662255-36662277 ATATTAAAACAATACAAGGCCGG + Intergenic
1147690121 17:42309630-42309652 ATTTTGAAGCTAGACATAGCAGG + Intronic
1148165997 17:45484507-45484529 ATATGTAAGGTATACATTGGTGG - Intronic
1150397220 17:64831231-64831253 ATATGTAAGGTATACATTGGTGG - Intergenic
1150780642 17:68119042-68119064 CTATTAAAGCTAAACATGCCAGG + Intergenic
1150931485 17:69590046-69590068 ATACTTAAGCTTCACATGGACGG - Intergenic
1153481724 18:5554087-5554109 ATATTTAAGGTGTGCAGGGCAGG - Intronic
1154458503 18:14553848-14553870 AAATTTGAGCTATACATTGTTGG + Intergenic
1154531477 18:15350344-15350366 ATAGTTAAGCTGTAAATGGAAGG - Intergenic
1155820347 18:30367905-30367927 TTATTTTAGCTATCCATGGATGG + Intergenic
1158451796 18:57573327-57573349 ATATTAATGCTAAACATGGGAGG - Exonic
1159777472 18:72620149-72620171 ACATTTAAGCTGTCCATGGATGG - Intronic
1160727994 19:626448-626470 ATATTTAAGCTATACATGGCTGG - Intronic
1162837560 19:13330993-13331015 ATATTCAAGCTATACACCCCAGG + Intronic
1165300882 19:34968028-34968050 ACACTTAAGCTATGCATGGATGG + Intergenic
1167155689 19:47737358-47737380 ATATTTAAAATATACACAGCTGG + Intronic
1167769037 19:51502284-51502306 ATATCTGAGCTCTCCATGGCAGG + Intergenic
925218667 2:2120287-2120309 AGCTTTAAGGTGTACATGGCTGG - Intronic
927365311 2:22288265-22288287 ATATTAAAGCTTTAAATAGCAGG + Intergenic
929846575 2:45535864-45535886 ACTTTTATGCTATACATGGGGGG + Intronic
930919287 2:56731971-56731993 AAATTTAAGCTATACTTGAAGGG + Intergenic
933016564 2:77135474-77135496 ATATTTAATCCAAACATTGCTGG - Intronic
933453651 2:82493017-82493039 ATCTTTAAGCAACACATGTCTGG - Intergenic
935014457 2:99167386-99167408 ATATTTAAGCTGTACCTGGTAGG + Intronic
935958198 2:108399414-108399436 ATAGTTAAGCCATTCATGGATGG + Intergenic
937072507 2:119074792-119074814 ATAATTAAGCCCTCCATGGCGGG + Intergenic
937819845 2:126297398-126297420 ATATTTAAACTATAGCAGGCAGG + Intergenic
938006629 2:127792363-127792385 CAATTTAAGCTATTCTTGGCAGG + Intronic
938530574 2:132181614-132181636 ATAGTTAAGCTGTAAATGGAAGG - Intronic
941427568 2:165367955-165367977 ACATTTAAGCCATCCATGGATGG - Intronic
941688181 2:168469267-168469289 ATATTTAAACTATGCAGAGCTGG - Intronic
942393011 2:175515752-175515774 TTATTTAAGCTATTTATAGCAGG + Intergenic
944392789 2:199235534-199235556 TTATTTCAGGTATACAAGGCTGG - Intergenic
944891044 2:204117678-204117700 ACACTTAAGCTATCCATGGATGG - Intergenic
946003541 2:216503693-216503715 ATAAAAAAGCAATACATGGCTGG - Intronic
947608178 2:231503885-231503907 ATATTTAAGCTAAAACTGGATGG + Intergenic
947855005 2:233317947-233317969 ATAATTAAGTTATATATGTCTGG + Intronic
1170462938 20:16596298-16596320 ACATTTTAGCCAAACATGGCTGG - Intergenic
1172982154 20:38951530-38951552 ATCTTTAAGTTTTACATGGACGG + Exonic
1175051912 20:56163579-56163601 ATATTTTTGGTATACATGACTGG + Intergenic
1176765879 21:13017814-13017836 ATAGTTAAGCTGTAAATGGAAGG + Intergenic
1178129032 21:29548827-29548849 CTATTTAAGGAATACATGGTGGG - Intronic
1180430511 22:15244657-15244679 ATAGTTAAGCTGTAAATGGAAGG + Intergenic
1180513065 22:16112563-16112585 ATAGTTAAGCTCTAAATGGAAGG + Intergenic
1182863492 22:33581912-33581934 ATCTTAAAGCTTCACATGGCTGG + Intronic
949558238 3:5177748-5177770 ATATTTAAGAAATTCATGGCCGG - Intronic
952584320 3:34872794-34872816 ATATTAATGCTAAACATGGGAGG + Intergenic
953942532 3:47112884-47112906 ATATTTAAAGTATTCTTGGCCGG - Intronic
956277506 3:67518707-67518729 ATATTTAACCTATCTATGACAGG - Intronic
959293763 3:104509135-104509157 ATATTTAAGAAATATATTGCTGG + Intergenic
959441519 3:106382241-106382263 ATATTTAAGCTTTAAATTGTAGG - Intergenic
959852216 3:111101967-111101989 ACATTTAAGCTATACCTTGAAGG - Intronic
960210379 3:114957603-114957625 TAATTTCAGCTATTCATGGCAGG + Intronic
963457682 3:145565721-145565743 ATATTCAAGTTATACATGGGAGG - Intergenic
965096375 3:164232324-164232346 AGATTAAAGATATTCATGGCCGG - Intergenic
968103263 3:195983168-195983190 ATATTAAAACAATCCATGGCCGG + Intergenic
968210908 3:196847967-196847989 ATAATTGAGCAAAACATGGCTGG - Intergenic
968301570 3:197620746-197620768 ATATTAAAACAATCCATGGCCGG + Intergenic
970339270 4:15087168-15087190 AACTTACAGCTATACATGGCTGG + Intergenic
971742899 4:30542347-30542369 ATCTTTAAGAAATCCATGGCCGG - Intergenic
975384586 4:73741145-73741167 ATAAATAAGTTATACATGCCTGG - Intronic
979083619 4:116376507-116376529 AAAGTTAAGTTATACAAGGCAGG + Intergenic
980350140 4:131673720-131673742 ATATTTCTGATTTACATGGCAGG + Intergenic
982538957 4:156643164-156643186 ATAATTAAGTTATACATATCAGG + Intergenic
985498805 5:227304-227326 ATATTAAAACAATCCATGGCCGG - Intronic
987768495 5:22268060-22268082 ATAATTAAAATATACATGGCAGG + Intronic
987850142 5:23341278-23341300 ATACTTAAAAAATACATGGCCGG + Intergenic
990916004 5:60906430-60906452 TCATTTAAACTATAAATGGCTGG + Intronic
991571177 5:68054893-68054915 ATATTTAAGCTGTGCTTTGCAGG + Intergenic
992021500 5:72629178-72629200 ATATTTATGATGTTCATGGCAGG - Intergenic
993735622 5:91473874-91473896 ATATTTGTGCTATACAAGGCAGG - Intergenic
994979828 5:106859855-106859877 ATAATTTACCTTTACATGGCTGG + Intergenic
995040990 5:107587815-107587837 ATATTAAAACTATAGGTGGCAGG - Intronic
995065917 5:107862384-107862406 ATAATTAAAACATACATGGCTGG + Intronic
995412362 5:111873147-111873169 ATATTTAAGATGTGCAAGGCAGG - Intronic
995887358 5:116910958-116910980 ATGTATAAGCAATACATGGAAGG + Intergenic
996242086 5:121216068-121216090 ACATTTAAGCCATCCATGGATGG + Intergenic
997463859 5:134073404-134073426 GTTTTTAAGCTATACATTGGCGG - Intergenic
997535902 5:134621171-134621193 ATTTTAAATCTATTCATGGCCGG + Intronic
999681170 5:154061621-154061643 AGATTTGAGCTAGACATGGAAGG + Intronic
1004005102 6:11631218-11631240 ATAATTAAGTTACACAGGGCGGG + Intergenic
1004963418 6:20819858-20819880 ATATTTAAGAAATACATTGTGGG + Intronic
1008076145 6:47148246-47148268 ATATCTAAGTCACACATGGCAGG - Intergenic
1008375590 6:50787665-50787687 ATATTTAACTTAGACATGGAGGG + Intergenic
1009980790 6:70723337-70723359 ACATTTAAGGTATACATTGAGGG - Intronic
1011208178 6:84924094-84924116 CTGTTTAAGCTAGACATAGCAGG - Intergenic
1011533412 6:88350325-88350347 ATATTTAAGGTATAAATGTAAGG + Intergenic
1012509602 6:99988148-99988170 ATGTTTAAGCTATTTAGGGCTGG - Intronic
1013764113 6:113554372-113554394 ATATTTCAGCAATACAAGGAAGG - Intergenic
1014594410 6:123315493-123315515 ATATTTAACATATACATAGAAGG + Intronic
1015782953 6:136890294-136890316 ATATTTAAGCTATCTAAGGATGG - Intronic
1021003329 7:15361001-15361023 ATATTCTAGCTATAGCTGGCTGG - Intronic
1021325595 7:19263243-19263265 AGATTTAAGTACTACATGGCTGG - Intergenic
1023395774 7:39750659-39750681 TTATTTATGTTATCCATGGCTGG + Intergenic
1027701518 7:81475844-81475866 AAATTTAAGATATAGATGGTGGG + Intergenic
1027704853 7:81517128-81517150 TTTTTTAAGCTATACTTGGAAGG - Intergenic
1029144688 7:98437335-98437357 TCATTTAAGCTACACCTGGCTGG + Intergenic
1029890441 7:103923878-103923900 ATATTTGAGCACTACATGCCAGG + Intronic
1039223825 8:35365663-35365685 AGATGTAAGCTAAAGATGGCAGG + Intronic
1041966549 8:63685014-63685036 ATATTTAACCTATACAACTCAGG - Intergenic
1042317589 8:67440251-67440273 TTCTTTAAGTGATACATGGCTGG - Intronic
1043075796 8:75697905-75697927 ATATTTATCCTATACATGCGTGG - Intergenic
1047854041 8:128890611-128890633 ACATTAAAGGTACACATGGCTGG + Intergenic
1048511869 8:135070305-135070327 ATACTTAAGCTGTCCATGGATGG + Intergenic
1049951676 9:650701-650723 ATACTTAAGCTTTACAAGTCTGG - Intronic
1050829138 9:9989705-9989727 ACATTTAAGCAATCCATGGATGG + Intronic
1050995857 9:12216460-12216482 ATAAGTAAACTAAACATGGCCGG - Intergenic
1052201388 9:25785564-25785586 ATATCGAAGAAATACATGGCAGG + Intergenic
1052793687 9:32902482-32902504 ATATTTAAGCTGGACATGGATGG + Intergenic
1053544997 9:39013757-39013779 ATATTTAAGGTATACAGGCCTGG - Intergenic
1053709186 9:40788117-40788139 ATAGTTAAGCTGTAAATGGAAGG - Intergenic
1053809397 9:41836948-41836970 TTATTTAAGGTATACAGGCCTGG - Intergenic
1054419096 9:64908914-64908936 ATAGTTAAGCTGTAAATGGAAGG - Intergenic
1054621195 9:67350480-67350502 TTATTTAAGGTATACAGGCCTGG + Intergenic
1055970849 9:81911338-81911360 ATATTTAAGCTCTAAAAGCCTGG - Intergenic
1057018291 9:91674781-91674803 ATATTCAAGGTATGCAAGGCTGG - Intronic
1058499450 9:105595825-105595847 ATCTATAAGCTATAGATGGGAGG - Intronic
1059179886 9:112201668-112201690 TTATAAAAGTTATACATGGCTGG + Intergenic
1185696130 X:2196078-2196100 ATCGTTAAGCAACACATGGCCGG - Intergenic
1185913943 X:4014120-4014142 ATATCTAAGCTATAGCAGGCAGG - Intergenic
1190623242 X:52309986-52310008 ATATGTAAGCTTTTCATGCCTGG - Intergenic
1192805429 X:74504553-74504575 ATATTTAAGTCATACAAGCCAGG + Intronic
1194507724 X:94753447-94753469 AGTTGTAAGCTATACATAGCTGG + Intergenic
1195169217 X:102249576-102249598 ATAATTATGTTATACATGCCAGG + Intergenic
1195189640 X:102437512-102437534 ATAATTATGTTATACATGCCAGG - Intronic
1195461289 X:105128182-105128204 ATATTTCAGCAAAACCTGGCAGG - Intronic
1196407919 X:115384810-115384832 ACTTTTGAGCTATACATGACTGG + Intergenic
1198890870 X:141394976-141394998 TTATTTCAGCTATGCAAGGCTGG + Intergenic
1199110301 X:143925182-143925204 TTATTCTAGCTATACAAGGCTGG + Intergenic