ID: 1160729133

View in Genome Browser
Species Human (GRCh38)
Location 19:632801-632823
Sequence CCCCCACGGCGGCCCGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160729133_1160729139 7 Left 1160729133 19:632801-632823 CCTCTCCCGGGCCGCCGTGGGGG 0: 1
1: 0
2: 3
3: 16
4: 182
Right 1160729139 19:632831-632853 CACCCTCCAGCAGCTCCACGTGG 0: 1
1: 0
2: 3
3: 43
4: 313
1160729133_1160729144 25 Left 1160729133 19:632801-632823 CCTCTCCCGGGCCGCCGTGGGGG 0: 1
1: 0
2: 3
3: 16
4: 182
Right 1160729144 19:632849-632871 CGTGGCCCCAGTCCTTCCTGCGG 0: 2
1: 0
2: 3
3: 18
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160729133 Original CRISPR CCCCCACGGCGGCCCGGGAG AGG (reversed) Intronic
902214043 1:14923761-14923783 TCCCCACAGCTGACCGGGAGAGG - Intronic
902413931 1:16227973-16227995 CCCCCGCGGCGGCGGGAGAGAGG - Intergenic
905301729 1:36990336-36990358 CCCAGATGGCGGCCCAGGAGTGG - Intronic
905538274 1:38740950-38740972 CCCTCACGGGGGGCCTGGAGGGG - Intergenic
905852224 1:41282843-41282865 CCCCCACTGCAGCCTGGTAGAGG - Intergenic
907268548 1:53277113-53277135 GCCCCAGGTCGGCCGGGGAGGGG - Intronic
912652149 1:111449119-111449141 TGCCCCCGGCGGCCCGGGAGTGG - Exonic
914753140 1:150549295-150549317 GCCCCTCGGCGGCCCCGGGGTGG - Intergenic
915463222 1:156081813-156081835 CCCCCACGGCGGGCGAGGACGGG - Exonic
920173218 1:204084312-204084334 CCCCCACAGCTGCCTGGGAGAGG - Intronic
1066653864 10:37681914-37681936 CCCCCACGGCAGCCCAGCCGGGG - Intergenic
1067744589 10:48926144-48926166 CCCCCACTGCCTCCCGGGAGAGG + Intronic
1069898935 10:71695969-71695991 CCCCCACGGCTGCCCAGCAGGGG + Intronic
1076607700 10:131700281-131700303 CCACCAAGGCGGCGAGGGAGCGG - Intergenic
1076728098 10:132422562-132422584 CCCCCATGGGAGCCCGAGAGAGG + Intergenic
1077081742 11:727415-727437 CCCTGAGGGGGGCCCGGGAGGGG + Exonic
1077322316 11:1947806-1947828 CCCCCACCGCAGCGCGGGCGCGG + Intronic
1077488077 11:2848189-2848211 CCCCCACACCGGCCAGGAAGAGG - Exonic
1080385110 11:31806233-31806255 CGCGCCCGGCAGCCCGGGAGGGG - Intronic
1083618048 11:64036034-64036056 CGCCCAGGGGGGCCCGGGAGAGG - Intronic
1083879355 11:65540456-65540478 TCCCCACGGCCGCCGGGGGGCGG + Intronic
1089646883 11:119886347-119886369 CCCCCACCGTGGGCCTGGAGGGG - Intergenic
1202805334 11_KI270721v1_random:3119-3141 CCCCCACCGCAGCGCGGGCGCGG + Intergenic
1091732543 12:2891366-2891388 CCCGCACCGCCTCCCGGGAGGGG - Intronic
1097262323 12:57726677-57726699 CCAGCACGGCTGCCCGGGTGAGG - Exonic
1101131914 12:101698229-101698251 GCCCCTCCGGGGCCCGGGAGAGG - Intronic
1104030994 12:125065674-125065696 CGCCCACAGCCGCCCGGAAGCGG - Exonic
1109262719 13:60163536-60163558 GCCCTACGGCGGGGCGGGAGCGG + Intronic
1112436104 13:99392368-99392390 CCCCTGCTGCGGCCTGGGAGAGG + Intergenic
1113311919 13:109140598-109140620 CGACGACGGCGGCCCGGGCGCGG + Exonic
1113820182 13:113208387-113208409 CCCCCACGGCGGCCCTGCAGGGG + Intronic
1114268497 14:21087324-21087346 CGGCCACGGAGGCCCGGGTGCGG - Exonic
1114637358 14:24195424-24195446 CTCCCACAGCGGCGCGGTAGCGG + Intronic
1117478346 14:56118874-56118896 CCCGGACGGCGGCGCGGGGGCGG + Intronic
1117920365 14:60721992-60722014 CCCCCACAGGGGCCCAGAAGCGG + Intronic
1119559446 14:75578602-75578624 GCCCCAAGCTGGCCCGGGAGAGG + Exonic
1119880022 14:78092483-78092505 CCCCCAAGGTGGCCCTGGTGAGG - Intergenic
1120914839 14:89701793-89701815 CCCCCACTCCGGCCCCGCAGGGG - Intergenic
1120976836 14:90256535-90256557 CCACCACTGCGGCCCGCCAGAGG - Exonic
1121417470 14:93788933-93788955 CCCTCACGCTGGCCCGCGAGAGG + Intergenic
1121764040 14:96470103-96470125 CCACCGCGCCCGCCCGGGAGAGG + Intronic
1122722218 14:103728435-103728457 ACCCCACGGCGGGCAGGCAGGGG - Intronic
1122827422 14:104377012-104377034 TCCCCACAGCAGCCCAGGAGAGG - Intergenic
1202852433 14_GL000225v1_random:30099-30121 TCCCCACGGAAGCCCGGGAACGG + Intergenic
1124129543 15:26971694-26971716 GCGGCACGGCGGGCCGGGAGGGG + Intronic
1128565832 15:68699985-68700007 CCCCCGCTGCAGCCTGGGAGGGG + Intronic
1129614000 15:77083767-77083789 CCCCCACGGAGTCCCATGAGAGG - Intronic
1132612033 16:821991-822013 CCCACACGGCTGCCCGGAAGTGG + Intergenic
1132725336 16:1335951-1335973 TCCCCAGAGCGGCCCGAGAGGGG - Intronic
1132879518 16:2155835-2155857 CGCCCGCGGCCGCCCGGGAGCGG - Exonic
1133033824 16:3023869-3023891 CCCCCAAGGCGGCCCGCGGGAGG + Exonic
1133038397 16:3046888-3046910 CCCCGCCGGCGGCCCGGGCTGGG + Exonic
1133324748 16:4936155-4936177 TTCCCAGGGCGGCCTGGGAGGGG - Intronic
1134202706 16:12212089-12212111 CCACCACCGAGGCCCAGGAGAGG - Intronic
1142133315 16:88440853-88440875 GGCCCACGGTGGCCCGAGAGTGG - Intergenic
1142230813 16:88899498-88899520 ACCCCAAGGCGGGCTGGGAGTGG + Intronic
1142234364 16:88914962-88914984 CCCCCACCCCGCCCCGGCAGCGG - Intronic
1142810255 17:2392807-2392829 CCCTCCCGGCTGCCCGGAAGCGG + Intronic
1143036807 17:4004167-4004189 CCCCCACGGCGCCCTGTGTGTGG + Intergenic
1144850941 17:18243696-18243718 GCCCCACTGAGGCCAGGGAGAGG - Intronic
1144944265 17:18961742-18961764 CCCCCACGGGGCCCCGGTGGGGG + Intronic
1147325693 17:39668386-39668408 CCCCCACAGCGGACCGGTCGGGG + Exonic
1147649132 17:42051978-42052000 CCCCCACAGCTGCCCCCGAGTGG + Intronic
1148060128 17:44830323-44830345 GTCCCGCCGCGGCCCGGGAGCGG + Intronic
1148084958 17:44988237-44988259 CTCCCACGGGGGCCTGGGATGGG - Intergenic
1148765617 17:50036843-50036865 CCTCCAGGCCAGCCCGGGAGGGG - Intergenic
1150108562 17:62479020-62479042 CCCCCGCGGCCGCCCGGGCCCGG + Exonic
1150608339 17:66713367-66713389 TCCCAACTGGGGCCCGGGAGTGG - Intronic
1151529747 17:74696644-74696666 GCCCCCCGGGGGCCCGGGAGGGG - Intronic
1152143836 17:78555505-78555527 CTGCCACGGCTGCCGGGGAGAGG + Intronic
1153688355 18:7567776-7567798 CACCCACCGCCGCCGGGGAGCGG + Exonic
1157668896 18:49511839-49511861 CCACCACGGCTGGCCTGGAGTGG + Intergenic
1157846346 18:51007146-51007168 CCCCCCGGGCGGCACTGGAGAGG + Intronic
1160501830 18:79405330-79405352 CCGACACGGCAGCCAGGGAGTGG + Intronic
1160729133 19:632801-632823 CCCCCACGGCGGCCCGGGAGAGG - Intronic
1160904574 19:1446232-1446254 GCCCCTCGGCGGCCAGGGTGGGG - Intergenic
1160921779 19:1524072-1524094 CCCTCAGAGCGGCCCCGGAGCGG + Intronic
1160952859 19:1675879-1675901 CCTCCCCGCCGGCCCGGGCGGGG + Intergenic
1161108766 19:2456902-2456924 TCCCGACGGCGGCCCGGGCTCGG + Exonic
1161312038 19:3600172-3600194 GCCCCACGGTGGCCCAGGCGCGG + Exonic
1162581869 19:11536220-11536242 GCCCCCTGGCGGCCCGGGAGGGG - Intergenic
1163063955 19:14779514-14779536 CCCCCACAGGAGCCCGGGACAGG - Intergenic
1163158204 19:15450068-15450090 CCCCCTCGCCGCCCCGGGGGGGG + Intergenic
1163427251 19:17246181-17246203 CTCCCGCCGCGGCCCGGCAGGGG - Intronic
1163442713 19:17329701-17329723 CCCCCATGGCGGCCAGCGAGGGG - Intronic
1163635431 19:18435104-18435126 GCCCCACGCAGGCCCTGGAGAGG + Exonic
1165068449 19:33241859-33241881 CCCCCACCGCCCCCGGGGAGGGG + Intergenic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1167045919 19:47048523-47048545 CCGCCTCAGCGGCCCCGGAGCGG - Exonic
1167353702 19:48991335-48991357 CCCCCACCCCGGCCCTGAAGAGG - Exonic
1167593371 19:50415948-50415970 CCCCCATGGCAGCCTGGGTGTGG + Intronic
925266809 2:2571555-2571577 CCTCCACGGGGGCCCGGCAGGGG - Intergenic
930011653 2:46942035-46942057 CCCCCACCGCGGTCCGAGGGTGG + Intronic
932611316 2:73202491-73202513 TCCCCACTGCGGTCCGGGCGGGG - Exonic
933724842 2:85420865-85420887 TCCCCACAGTGGCCCGGGACGGG + Intronic
934561539 2:95316043-95316065 CCCCCACAGCAGCCCAGCAGTGG + Intronic
934566935 2:95346470-95346492 CCCCCGCGCCTGCCCGGGAAGGG - Intronic
934715135 2:96538631-96538653 TCCACTCGGCAGCCCGGGAGCGG - Intronic
935592681 2:104856045-104856067 CCCCCAGGGTGGCCCTGGTGTGG - Exonic
938795953 2:134718650-134718672 CGCCCAGCGCGGCCCGCGAGTGG + Intronic
938949587 2:136244251-136244273 CCCCCAGGGAGGGCCGGGGGTGG + Intergenic
946412630 2:219522730-219522752 CCCCCGCGGCGGCCGGGGAGGGG - Intronic
946688661 2:222295053-222295075 CCGCCACGGCAGCCTGGGGGAGG - Intronic
949014798 2:241702844-241702866 CCCTGACGTCGGCCCGGGATGGG + Intronic
1169142665 20:3234991-3235013 CTCCCACCACGGCCCGAGAGTGG - Intronic
1175288024 20:57850867-57850889 CTCCCACAGGGGCCTGGGAGAGG + Intergenic
1175415931 20:58800944-58800966 CCCCCACGCCGGCTCAGGACGGG + Intergenic
1175813958 20:61873977-61873999 CCCCGACGGCGCCACTGGAGAGG - Intronic
1176286114 21:5020482-5020504 CCCCCAGTGCCGCCCGGGGGCGG - Intergenic
1179437177 21:41369846-41369868 CAGCCACGGCGGGGCGGGAGCGG - Intronic
1179584241 21:42364912-42364934 CCCCCACAGTGTCCCGGGGGTGG - Intronic
1179871067 21:44242993-44243015 CCCCCAGTGCCGCCCGGGGGCGG + Intergenic
1180069177 21:45427585-45427607 GCACCACGGCGGGCGGGGAGCGG + Intronic
1180087068 21:45512448-45512470 CCCCCACCGTGGGCAGGGAGCGG + Exonic
1180166421 21:46033121-46033143 CCCCCTCCGAGGCCCGGGACTGG - Intergenic
1180166436 21:46033156-46033178 CCCCCTCCGAGGCCCGGGACTGG - Intergenic
1180166451 21:46033191-46033213 CCCCCTCCGAGGCCCGGGACTGG - Intergenic
1180166466 21:46033226-46033248 CCCCCTCCGAGGCCCGGGACTGG - Intergenic
1180703236 22:17793094-17793116 CGCCCACGGCCGCCAGGCAGGGG + Intronic
1181312523 22:21952870-21952892 CGCCCGCGGCGGCCAGGGACGGG - Intergenic
1182558942 22:31143864-31143886 CCCCCACTGCAGACCAGGAGAGG + Intergenic
1183401757 22:37609007-37609029 CCCCGCCCCCGGCCCGGGAGGGG + Intronic
1183466743 22:37983910-37983932 CCCCGAGGGCGGCCCGAGACAGG + Intronic
1183739536 22:39662291-39662313 CCCTCCAGGCGGCCCGGGGGTGG - Exonic
1184152892 22:42648998-42649020 GCCCCACGGCGGCCAGGGCAGGG + Intronic
1184649527 22:45913218-45913240 CCCCCAAGGCGGGCAGGGGGAGG + Intergenic
1184673528 22:46027962-46027984 CACCCACGGCAGCCGGAGAGGGG - Intergenic
1184774796 22:46617763-46617785 CACCCAGGGGGGCCAGGGAGCGG - Intronic
1184991258 22:48171506-48171528 CCCCCAGGGCAGACAGGGAGGGG - Intergenic
950262892 3:11554973-11554995 CCCCCTCTGCTGCCCAGGAGTGG + Exonic
955916267 3:63911918-63911940 GCCCCAGGGCAGCGCGGGAGAGG - Intronic
958732330 3:97972490-97972512 CCGCCACGCCGGCCCGCAAGTGG + Intergenic
960582745 3:119294683-119294705 TCGGCACGGCGGCCCCGGAGCGG + Exonic
964358519 3:155871168-155871190 GCCCCACAGCGGCGCGGGGGAGG - Intronic
964720500 3:159764301-159764323 CCCCCAAGGAGGCCTGGGGGCGG - Intronic
968133868 3:196208184-196208206 CCACCGCGCCGGCCCGGGGGAGG + Intronic
969228686 4:5815200-5815222 ACCCCACCGAGACCCGGGAGTGG - Intronic
973854136 4:54993746-54993768 AGCCCACGGCGGGCCGGGGGAGG - Intergenic
976398627 4:84583376-84583398 CCGCCACGGCAGCGCGGGAGCGG + Exonic
976600557 4:86934748-86934770 CCCCCACAGCAGCCCGGGGCAGG + Intronic
979785737 4:124712941-124712963 CCCCCACGCCGCCCCGAGACAGG - Intergenic
986306980 5:6523249-6523271 CCCTCACGCTGGCCCGGGTGGGG + Intergenic
989178731 5:38556248-38556270 CCCCAGGGGCGGCCCGGGCGGGG - Intronic
991216920 5:64166052-64166074 CCCCCACGTTGGCCCAGGCGGGG + Intronic
992813087 5:80408426-80408448 ACACTCCGGCGGCCCGGGAGCGG - Intronic
996862780 5:128084133-128084155 GCCCCGCGGCGGCCGGGGACGGG + Exonic
997640683 5:135446912-135446934 CCCTCACTGAGGCCCTGGAGAGG + Exonic
998140505 5:139697189-139697211 CCCCCACCCCGCCCCAGGAGGGG - Intergenic
998957638 5:147453732-147453754 CCGCCGCGGGAGCCCGGGAGGGG - Intronic
1000014638 5:157266289-157266311 CGCCCCCCGCGGGCCGGGAGAGG - Intronic
1002140345 5:177133918-177133940 CCCCCCAGCTGGCCCGGGAGGGG + Exonic
1002593107 5:180304626-180304648 CCCCACAGGCGGCCCGGGGGAGG + Intronic
1002925774 6:1604993-1605015 CCCTCACCCCGGCCGGGGAGTGG - Intergenic
1002991721 6:2245200-2245222 CCCTCTCGGCGTCCCGGAAGGGG - Intronic
1003593777 6:7456732-7456754 CTCCCCCTGCGGCCCGGGTGCGG + Intergenic
1005535335 6:26749603-26749625 CCGCCACCGCCGCCCGGAAGTGG + Intergenic
1006430650 6:33993597-33993619 CCCCCATGGCGGGGCGGGGGTGG - Intergenic
1006725511 6:36196817-36196839 GCCCCAGCGCGGGCCGGGAGGGG + Exonic
1007401000 6:41602274-41602296 CCTCCACGGAGGGCTGGGAGGGG - Exonic
1007701778 6:43770118-43770140 CCCCCGGGGCGGGCCGGGGGCGG + Intergenic
1009006371 6:57793236-57793258 CCGCCACCGCCGCCCGGAAGTGG + Intergenic
1011517327 6:88167212-88167234 CCCCCAGTCCGGCCCTGGAGTGG - Intergenic
1018101091 6:160441157-160441179 CCTTCACTGCAGCCCGGGAGTGG + Intronic
1021868345 7:24980109-24980131 CCCGCCAGCCGGCCCGGGAGAGG - Exonic
1022094569 7:27130619-27130641 CGCAGACGGCGGCCCGGGCGGGG - Exonic
1022410296 7:30134893-30134915 CCCCCACGGCGGCCCGCAAGGGG + Exonic
1034451127 7:151137896-151137918 CCCTCACTGTGGTCCGGGAGCGG - Intronic
1035297722 7:157876650-157876672 CCCCCACGTGGGGCTGGGAGAGG + Intronic
1038632929 8:29262901-29262923 CCCCCACGGCGGCCGAGGGAAGG + Intronic
1040315568 8:46259121-46259143 CCCCCACGGCTGCCCTGGATGGG + Intergenic
1042246430 8:66712873-66712895 CTCCGACGGCGGCCCGGGGCGGG + Intronic
1042850746 8:73213650-73213672 GCCCCACTGCAGCCCAGGAGAGG + Intergenic
1045510852 8:102810834-102810856 CGCCCAGGTCGGCCGGGGAGAGG + Intergenic
1046031467 8:108787611-108787633 CCGCCACGGCGGGCGGGGTGGGG + Exonic
1049429203 8:142551340-142551362 CCCCCACAGCAGCCCCGGGGTGG - Intergenic
1050472589 9:6008150-6008172 GCCCCCCGCTGGCCCGGGAGGGG - Intergenic
1055090986 9:72364795-72364817 CCGCCGCCGCGGGCCGGGAGCGG + Intronic
1055576140 9:77661754-77661776 CCCCCACGACAGCCTGGGGGTGG - Intergenic
1057047923 9:91900199-91900221 CCCCCAGGGCCGCCAGGGGGTGG + Intronic
1057172207 9:92969678-92969700 CCCGCACGGCCTCCCGGGAAGGG + Intronic
1057208183 9:93185343-93185365 CCCCGACGGCGGCCCCAGGGAGG + Exonic
1057596586 9:96419365-96419387 CGCCGACCGCGGCCCGGGTGGGG + Intergenic
1059234494 9:112750684-112750706 GCGCCGCGGCCGCCCGGGAGGGG - Intergenic
1060209176 9:121699689-121699711 TGCCCGCGGCGGCCCGGGCGAGG + Intronic
1061028658 9:128066828-128066850 CCTCCACGGCGGCCCGGACCTGG + Exonic
1061489818 9:130938732-130938754 GCGCCGGGGCGGCCCGGGAGCGG + Exonic
1062119115 9:134824593-134824615 CCCCCAGGGCCCCCCGGGAGAGG + Exonic
1062324184 9:136004538-136004560 CCCACCAGGCGGCCCGTGAGGGG - Intergenic
1062566391 9:137165748-137165770 CCCCTGCGACGGCCCTGGAGGGG + Intronic
1203794674 EBV:169995-170017 CCCCCAAGGGGGGCGGGGAGCGG + Intergenic
1203794875 EBV:170533-170555 CCCCCAAGGGGGGCGGGGAGCGG + Intergenic
1203795066 EBV:171056-171078 CCCCCAAGGGGGGCGGGGAGCGG + Intergenic
1203795267 EBV:171594-171616 CCCCCAAGGGGGGCGGGGAGCGG + Intergenic
1185473673 X:400335-400357 CCCACAAGGCGCCCCAGGAGAGG - Intergenic
1187155809 X:16719701-16719723 CCGCGGCGGCGGCCCGCGAGCGG + Exonic
1191717990 X:64205956-64205978 CCCCCACGCCGGGCTGGTAGTGG + Intergenic
1191853400 X:65602951-65602973 CCCCTACTGAGGCCAGGGAGGGG + Intronic
1196842545 X:119871811-119871833 GCCCCGCGGCCGCCCGCGAGCGG - Exonic
1199772702 X:150984308-150984330 GCCCCCGGGCGGCCCGGGCGGGG + Intronic
1199772833 X:150984712-150984734 CCGCAGCGGCGGCCCGGGCGGGG - Intronic
1199846282 X:151694933-151694955 GCCCCCCGGCGGCACGGGCGGGG + Intergenic
1200129004 X:153830920-153830942 CGCCCACGGCGGCGGGGGAGGGG + Intergenic