ID: 1160730626

View in Genome Browser
Species Human (GRCh38)
Location 19:640219-640241
Sequence CGCCCGCGGGGGAGTCCCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 9, 3: 5, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160730619_1160730626 -4 Left 1160730619 19:640200-640222 CCGTCTTCACGGTGACCTGCGCC 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1160730626 19:640219-640241 CGCCCGCGGGGGAGTCCCGGAGG 0: 1
1: 0
2: 9
3: 5
4: 117
1160730618_1160730626 -1 Left 1160730618 19:640197-640219 CCGCCGTCTTCACGGTGACCTGC 0: 1
1: 0
2: 0
3: 4
4: 91
Right 1160730626 19:640219-640241 CGCCCGCGGGGGAGTCCCGGAGG 0: 1
1: 0
2: 9
3: 5
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160730626 Original CRISPR CGCCCGCGGGGGAGTCCCGG AGG Intronic
900419912 1:2551742-2551764 CGCCAGGGGGAGAGTCCTGGAGG - Intergenic
900424516 1:2569899-2569921 CGCCAGGGGGAGAGTCCTGGAGG + Intergenic
900743588 1:4345138-4345160 CGCACGCAGGGGTGTCCGGGTGG - Intergenic
901641263 1:10694262-10694284 CGCGGGCGGGGGAGGCCCGGGGG - Intronic
905584259 1:39105113-39105135 GGCCCACGCGGGAGTCCCGCTGG - Intronic
906516626 1:46442920-46442942 CGCCCGCGGGAAAGTCCAGGAGG - Intergenic
906962690 1:50427966-50427988 CCCCCGAGGCGGAGTCCCAGCGG + Intergenic
914718269 1:150268870-150268892 CGCCAGCTGGGGAGTCCGCGTGG + Exonic
1065214765 10:23439135-23439157 CGGCCGCTGGGGACTCACGGAGG - Intergenic
1066180680 10:32958205-32958227 AGCCCGCGGGAGAGGCCCAGCGG - Intronic
1074483930 10:113854820-113854842 GGCCCGCGGGAGAGTCTCGCTGG - Exonic
1076998567 11:311078-311100 CCCCCTCGGGGGTCTCCCGGAGG + Intronic
1077000176 11:318681-318703 CCCCCTCGGGGGTCTCCCGGAGG - Intergenic
1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG + Exonic
1083609863 11:63999610-63999632 GGCCCGCGGGGGAGGGCGGGAGG - Intronic
1083726314 11:64630367-64630389 GGCCCGCGGAGGAGGCGCGGTGG - Intronic
1092155406 12:6278834-6278856 CGGCCGCGGGTGAGTCAGGGCGG - Intergenic
1098105836 12:67068900-67068922 GGCCCGCGGGCGAATCCAGGTGG - Intergenic
1099315528 12:81078241-81078263 GGCCCGCGGGGCGGTCTCGGGGG + Exonic
1099989541 12:89708525-89708547 CACCTGCGGGGGAGGCCAGGCGG - Intronic
1103509817 12:121466875-121466897 CGCCCGACGGCGAGGCCCGGCGG + Intronic
1104929310 12:132329666-132329688 GGCGCGCGGGGCGGTCCCGGGGG - Intergenic
1105054035 12:133080888-133080910 CGCCCGCGGAGGGGCCCTGGGGG + Exonic
1107624801 13:42271847-42271869 AGCCCGCGGGGCAGCCCCGCTGG - Intergenic
1113311876 13:109140441-109140463 CGCGCACTGCGGAGTCCCGGGGG - Exonic
1115852609 14:37599623-37599645 CGCCCGCGGGCGAGGCCGGGTGG - Intronic
1118854625 14:69611558-69611580 CGCGGGCGGGGGAGGCCCCGCGG - Intergenic
1122131026 14:99604523-99604545 CGCCCGCGGCCGGCTCCCGGCGG + Intergenic
1123630782 15:22258297-22258319 CCCGCGCGGGGGAGGCCGGGGGG - Intergenic
1124426889 15:29570413-29570435 CGCCCGCGGTGGCGTCCCGGCGG + Intronic
1128637721 15:69313876-69313898 TGCCAGCTGGGGAGTCCTGGGGG + Intronic
1130295925 15:82647222-82647244 CGCCGGAGAGGGAGTCTCGGGGG - Intronic
1130537762 15:84799202-84799224 CACCTGCGGGTGAGTCCCTGGGG + Exonic
1132756628 16:1488388-1488410 ACCCCGCGTGGGAGTCCGGGAGG + Exonic
1132759402 16:1501514-1501536 TGCACGCGGTGGGGTCCCGGGGG - Intronic
1135016015 16:18925897-18925919 CGCCCGAGGCGGAGCCCGGGAGG + Intronic
1135321636 16:21501724-21501746 CGCCCGAGGCGGAGCCCGGGAGG + Intergenic
1135437326 16:22437523-22437545 CGCCCGAGGCGGAGCCCGGGAGG - Intergenic
1136333111 16:29594834-29594856 CGCCCGAGGCGGAGCCCGGGAGG + Intergenic
1136447807 16:30334922-30334944 CGCCCGAGGCGGAGCCCGGGAGG + Intergenic
1136913631 16:34162554-34162576 GGCCCGCGGGGGAGTCCGTTCGG + Intergenic
1139545674 16:67648515-67648537 CGCCCGCGGGGGCGTGGCCGGGG - Intronic
1141582833 16:85011820-85011842 CGCCCGCGGCGGTGTCTCAGAGG + Intergenic
1141828879 16:86498588-86498610 CGCCCAAGGGGCAGTCCCGGCGG + Intergenic
1142120355 16:88383704-88383726 CGCCCGGGCGGGCGGCCCGGAGG - Intergenic
1142421449 16:89972843-89972865 CGGCCGCGGGGGAGCGCGGGAGG + Intergenic
1142990026 17:3724167-3724189 CGGCGGCGGAGGCGTCCCGGCGG + Exonic
1143130589 17:4674641-4674663 AGCCCGCGGGGGAGCCCTGATGG - Exonic
1143620883 17:8079714-8079736 TGCCCGCGAGGGAGGCCGGGAGG + Intronic
1148262239 17:46193550-46193572 GGCCCGCGGGGGCGGCGCGGCGG - Intronic
1148782450 17:50129621-50129643 CGGCCGCGGGGGGCTCCGGGCGG + Exonic
1150643456 17:66964587-66964609 CGGCGGCGGGGGAGGCGCGGAGG + Intergenic
1151714600 17:75824996-75825018 GGCCCGAGGGGGAGTGCTGGGGG + Exonic
1151882585 17:76904181-76904203 CACGTGCGGGGGAGTCCCCGAGG + Intronic
1152923853 17:83079030-83079052 TGACCGGGGGGGAGGCCCGGCGG - Intergenic
1152923888 17:83079122-83079144 CGCCCGCTGGCGAGGCGCGGGGG + Intergenic
1154304032 18:13217905-13217927 GGAGCGCGGGGGAGGCCCGGGGG + Intronic
1155199347 18:23503585-23503607 CGCCCGCGGCGGGGGCCCCGGGG - Exonic
1156502031 18:37566182-37566204 CGCCGACGGGGGAGGCGCGGTGG - Intergenic
1160500894 18:79400666-79400688 CGCTCGCGGCGGGGTCCTGGGGG + Intronic
1160730626 19:640219-640241 CGCCCGCGGGGGAGTCCCGGAGG + Intronic
1160992209 19:1864418-1864440 CGCCCGCGGCGGGGCCCGGGAGG + Intergenic
1162802341 19:13118420-13118442 CGCGCTCCGGGGGGTCCCGGCGG - Exonic
1165685601 19:37817327-37817349 CGCCCACCGCCGAGTCCCGGAGG - Intergenic
926101747 2:10122504-10122526 CGTCCACGGGGGTGTCCCCGGGG + Exonic
928883462 2:36122807-36122829 AGCCAGCTGGGGAGTCCAGGTGG - Intergenic
930008422 2:46915873-46915895 CGCCAGCGGGAGGGGCCCGGCGG - Intronic
932180713 2:69643743-69643765 CGCGCGCGGGGGAGGGGCGGCGG - Intronic
934678247 2:96265323-96265345 CGCCGGCGGAGGAGCCCGGGAGG - Exonic
937993301 2:127675610-127675632 CGCCGGGCGGGGCGTCCCGGCGG - Intronic
947521311 2:230848133-230848155 GGCCCGGCGGGGACTCCCGGAGG + Intergenic
1169006710 20:2213354-2213376 CGCCAGTGGAGGAGTCCGGGGGG + Intergenic
1174055297 20:47794452-47794474 CGCTCCCTGGGGAGTCCTGGGGG + Intergenic
1174246781 20:49187961-49187983 AGCCCGCGGGGCCTTCCCGGAGG - Intronic
1176548565 21:8212153-8212175 GGCCCGCGGGGGAGTCCCGTCGG + Intergenic
1176549446 21:8214885-8214907 CCCTCGCGGGGGATTCCCCGCGG - Intergenic
1176556459 21:8256361-8256383 GGCCCGCGGGGGAGTCCCGTCGG + Intergenic
1176557341 21:8259114-8259136 CCCTCGCGGGGGATTCCCCGCGG - Intergenic
1176567496 21:8395188-8395210 GGCCCGCGGGGGAGTCCCGTCGG + Intergenic
1176568374 21:8397919-8397941 CCCTCGCGGGGGATTCCCCGCGG - Intergenic
1176575398 21:8439403-8439425 GGCCCGCGGGGGAGTCCCGTCGG + Intergenic
1176576283 21:8442149-8442171 CCCTCGCGGGGGATTCCCCGCGG - Intergenic
1179571321 21:42280463-42280485 CGCCCGCCGGGAAGCCCCAGGGG + Intronic
1179783799 21:43718806-43718828 CGCACGCAGGGGAGACTCGGGGG - Intergenic
1180002167 21:45000127-45000149 CGCCCAGGGTGGAGTCCCTGTGG - Intergenic
1180235947 21:46459336-46459358 AGGCCGCGTGGGGGTCCCGGGGG - Intronic
1180736990 22:18024522-18024544 CAGCCCCGGCGGAGTCCCGGCGG - Exonic
1181542873 22:23583329-23583351 CGCCCCCGGGTGTGTCCCTGGGG + Intergenic
1181652916 22:24270830-24270852 GGCCCGCGAGGGAGGCCGGGCGG + Exonic
1184259898 22:43308736-43308758 GGCCCTCGGGGGACTCCCGATGG - Intronic
1184712752 22:46262842-46262864 GGGCCGCGGGGGAGGCCGGGCGG + Exonic
1185375675 22:50481742-50481764 CGACCGCGGAGGACTCCCCGAGG + Exonic
1203253449 22_KI270733v1_random:128458-128480 GGCCCGCGGGGGAGTCCCGTCGG + Intergenic
1203254333 22_KI270733v1_random:131207-131229 CCCTCGCGGGGGATTCCCCGCGG - Intergenic
1203261503 22_KI270733v1_random:173536-173558 GGCCCGCGGGGGAGTCCCGTCGG + Intergenic
1203262389 22_KI270733v1_random:176286-176308 CCCTCGCGGGGGATTCCCCGCGG - Intergenic
954200537 3:49021052-49021074 CGAGCGCGGGGGTGTCCCCGAGG - Exonic
954224086 3:49171677-49171699 CACCGGCGGGTGAGTCCCGCGGG + Exonic
956677934 3:71753419-71753441 CGCCCGCGCTGGGGTCACGGTGG - Intronic
962263156 3:133927648-133927670 GGGCCGCGGGGGCGTCCCGTGGG + Intergenic
966860842 3:184230225-184230247 CACCCCCGGGGGAGCCGCGGCGG + Intronic
967859600 3:194141290-194141312 CGCCCGCCGGGGCGGCCCGGGGG + Intergenic
968453687 4:686846-686868 CGCCCTCGGGGGAGGCAGGGTGG - Intronic
969858610 4:10019034-10019056 CGCCCGCGAGGGAGGCCACGAGG + Exonic
971230844 4:24799484-24799506 CCTCCGCGGGGGCGTCCCGCAGG + Exonic
979231359 4:118352432-118352454 CGCCGGCGGGGCAGCCCCAGGGG + Exonic
981782858 4:148445483-148445505 CGCCCGCGGAGGCGGCTCGGCGG + Intergenic
981920236 4:150078538-150078560 GGCCCCCGGGGGAGTCGCGCGGG - Intronic
985580506 5:693308-693330 CGCGCGCGGCCGAGTCGCGGAGG - Exonic
1002927312 6:1611798-1611820 CGGCGGCGGGGGAGGCCAGGAGG + Exonic
1003212419 6:4079342-4079364 GCCCCGCGGGGGAGGCCGGGCGG - Exonic
1005915138 6:30345057-30345079 CGCCCTCGGGAGCCTCCCGGAGG - Intronic
1007362954 6:41371785-41371807 GGCTCGCGGGGGAGTCCTGCGGG - Intergenic
1017174989 6:151494206-151494228 CGCGCGCGGGGGTGGCCCTGGGG + Intronic
1019663895 7:2241912-2241934 GGCCGGCGGCGGAGTCCAGGTGG - Intronic
1023918284 7:44606864-44606886 CGCCCGCCGGGCAGGCCCCGCGG - Intronic
1034223032 7:149460278-149460300 CGGCCGCGCGCGAGCCCCGGCGG - Intronic
1034228111 7:149498051-149498073 CGCCCGCGGGCGCGGCCAGGCGG - Intergenic
1042591397 8:70402521-70402543 TCCCCTCGGGGGAGTCCCAGAGG - Intronic
1045047577 8:98294092-98294114 CGGCCGAGGCGGAGTCCCCGGGG + Exonic
1045815193 8:106270407-106270429 GGCGCCCGGGGGAGTCCAGGAGG + Intronic
1051867301 9:21696414-21696436 GGCACGCGGGGGAGCCCAGGTGG - Intergenic
1052991775 9:34522905-34522927 CGGCCGAGGGGGAGGGCCGGGGG - Exonic
1058908239 9:109498323-109498345 CGCCCGCGGGCGGTTCCCGCCGG + Intergenic
1062022552 9:134326344-134326366 CGCCGGCGGGGGGGTGGCGGGGG - Intronic
1203469849 Un_GL000220v1:111605-111627 GGCCCGCGGGGGAGTCCCGTCGG + Intergenic
1203470734 Un_GL000220v1:114351-114373 CCCTCGCGGGGGATTCCCCGCGG - Intergenic
1203477670 Un_GL000220v1:155577-155599 GGCCCGCGGGGGAGTCCCGTCGG + Intergenic
1203478555 Un_GL000220v1:158323-158345 CCCTCGCGGGGGATTCCCCGCGG - Intergenic
1190279292 X:48918778-48918800 CGGCGGCGTGGGGGTCCCGGGGG + Exonic
1199793238 X:151174391-151174413 CATCCGCGGGGAATTCCCGGGGG + Intergenic
1200173567 X:154097009-154097031 CGCTCGCGGGGGGGTAGCGGGGG + Intronic