ID: 1160736430

View in Genome Browser
Species Human (GRCh38)
Location 19:664651-664673
Sequence TGTTTTTTAGAGATGGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160736428_1160736430 8 Left 1160736428 19:664620-664642 CCTGTGCATTTAGATTTTTTGTT No data
Right 1160736430 19:664651-664673 TGTTTTTTAGAGATGGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160736430 Original CRISPR TGTTTTTTAGAGATGGAGTC TGG Intergenic
No off target data available for this crispr