ID: 1160741610

View in Genome Browser
Species Human (GRCh38)
Location 19:688886-688908
Sequence ACCACGCCCGGCCCCACACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 0, 2: 7, 3: 68, 4: 355}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160741600_1160741610 16 Left 1160741600 19:688847-688869 CCTCGGCCTCCCAAAGTGCTGGG 0: 114360
1: 259489
2: 214307
3: 130302
4: 170463
Right 1160741610 19:688886-688908 ACCACGCCCGGCCCCACACAGGG 0: 1
1: 0
2: 7
3: 68
4: 355
1160741606_1160741610 6 Left 1160741606 19:688857-688879 CCAAAGTGCTGGGGTTACAGGTG 0: 1175
1: 72524
2: 207128
3: 250718
4: 204158
Right 1160741610 19:688886-688908 ACCACGCCCGGCCCCACACAGGG 0: 1
1: 0
2: 7
3: 68
4: 355
1160741603_1160741610 10 Left 1160741603 19:688853-688875 CCTCCCAAAGTGCTGGGGTTACA 0: 4078
1: 294830
2: 265780
3: 152940
4: 134736
Right 1160741610 19:688886-688908 ACCACGCCCGGCCCCACACAGGG 0: 1
1: 0
2: 7
3: 68
4: 355
1160741597_1160741610 20 Left 1160741597 19:688843-688865 CCCGCCTCGGCCTCCCAAAGTGC 0: 84291
1: 218536
2: 234154
3: 158283
4: 172560
Right 1160741610 19:688886-688908 ACCACGCCCGGCCCCACACAGGG 0: 1
1: 0
2: 7
3: 68
4: 355
1160741605_1160741610 7 Left 1160741605 19:688856-688878 CCCAAAGTGCTGGGGTTACAGGT 0: 1226
1: 77023
2: 304902
3: 244995
4: 149824
Right 1160741610 19:688886-688908 ACCACGCCCGGCCCCACACAGGG 0: 1
1: 0
2: 7
3: 68
4: 355
1160741598_1160741610 19 Left 1160741598 19:688844-688866 CCGCCTCGGCCTCCCAAAGTGCT 0: 87986
1: 182858
2: 138884
3: 74939
4: 51691
Right 1160741610 19:688886-688908 ACCACGCCCGGCCCCACACAGGG 0: 1
1: 0
2: 7
3: 68
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160741610 Original CRISPR ACCACGCCCGGCCCCACACA GGG Intronic
900261852 1:1735128-1735150 GCCACGCCCGGCCCCGCATTGGG - Intronic
900728165 1:4232375-4232397 ACCGCGCCCGGCCCTGAACATGG - Intergenic
901426141 1:9183155-9183177 GCCAAGCCCTGCCCCACGCAAGG - Intergenic
901504321 1:9675094-9675116 ACCGCGCCCGGCCTCAAACAGGG - Intronic
901678291 1:10899283-10899305 ACCGCGCCCGGCCCCCTACAGGG - Intergenic
902345268 1:15812063-15812085 ACCACGCCCGGCCACAGATATGG + Intergenic
902402445 1:16165631-16165653 ACCAGGCCTGGGCCCTCACAAGG + Intergenic
902977438 1:20099079-20099101 ACCACGCCTGGCCCCGAACCTGG - Intergenic
903283361 1:22262768-22262790 ACCAGGCCCGGCCCCACCCAGGG - Intergenic
903581117 1:24371886-24371908 ACCACGCCCAGCCCCACAGCTGG - Intronic
904125335 1:28234421-28234443 ACCACGCCCAGCCCCAAAGAAGG + Intergenic
904587939 1:31590359-31590381 ACCATGCCCGCCACCACACCAGG + Intergenic
905818407 1:40970005-40970027 ACCACGCCCGGCCCGGCTTATGG + Intergenic
906043128 1:42804874-42804896 ACTGCGCCCGGCCCCACATGTGG + Intergenic
907148001 1:52254397-52254419 ACCACGCCCAGCCACACATATGG - Intronic
907204545 1:52757384-52757406 ACCACGCCCGGCCCGATGTAAGG - Intronic
910697456 1:90035780-90035802 ACCACGCCCGGCCAAAGATAAGG - Intergenic
912817793 1:112843481-112843503 ACCGCGCCCGGCCCCAGATTGGG - Intergenic
915403462 1:155641367-155641389 ACCACGCCCAGCCCCAATTAGGG + Intergenic
917777057 1:178349086-178349108 ACCGCGCCCGGCCCGACACCAGG + Intronic
919402705 1:197139305-197139327 ACCGCGCCCGGCCAAAAACATGG - Intronic
919510701 1:198460177-198460199 ACCATGCCCGGCCCAGAACATGG + Intergenic
921167144 1:212515256-212515278 GCCCCGCCCCGCCCCGCACACGG + Intergenic
921706508 1:218327591-218327613 ACCACGCCTGGCCTTAAACAAGG + Intronic
921872098 1:220152364-220152386 ACCACGCCCAGCCCCTCTAATGG + Intronic
921935118 1:220788497-220788519 ACCGCGCCTGGCCCAAAACATGG - Intronic
922364838 1:224854165-224854187 ACCACCCGCTGCCCCACCCATGG + Intergenic
923270173 1:232348209-232348231 ACCATGCCTGGCCCCACCCAGGG + Intergenic
923322431 1:232847905-232847927 ACCGCGCCCGGCCGCAGAGAGGG - Intergenic
923602850 1:235418915-235418937 ACCACGCCCGGCCCTCCCCAGGG - Intronic
924127425 1:240869648-240869670 ACCACGCCCAGCCTCATTCATGG - Intronic
924647738 1:245894716-245894738 ACCATCCCCAGCCCAACACATGG - Intronic
924781333 1:247151188-247151210 ACCGCGCCCAGCCCAACACATGG - Intronic
1064081485 10:12311418-12311440 ACCGCGCCCGGCCTCAAACAGGG - Intergenic
1065168442 10:23004925-23004947 ACCACGCCCGGCCCCCCTCTTGG - Intronic
1065528170 10:26643300-26643322 ACCAAGGCCAGCCCCACTCAGGG + Intergenic
1065549385 10:26855679-26855701 ACCGCACCCGGCCCTAAACAGGG - Intronic
1066219340 10:33320021-33320043 ACCACGCCCGGCCCCGGAGCAGG - Intronic
1067414017 10:46090493-46090515 ACCAGACCTGGCCCCACTCAGGG + Intergenic
1067434070 10:46265004-46265026 ACCAGACCTGGCCCCACTCAGGG + Intergenic
1068507776 10:57924632-57924654 ACCACGCCCGGCCAAAAAAAAGG + Intergenic
1069226190 10:65947986-65948008 ACCGCGCCTGGCCGCGCACATGG - Intronic
1069929563 10:71873429-71873451 ACCACGCCCGGCCTGAGATAGGG + Intergenic
1070061205 10:72984589-72984611 ACCACACCCAGCCCCACTTAAGG - Intergenic
1070450958 10:76556640-76556662 ACCACGCCCGGCCATTCATATGG + Intronic
1070644923 10:78195223-78195245 GCCATCCCCGGCCCCCCACAGGG - Intergenic
1071554753 10:86593427-86593449 ACCACGCCCAGCCACACAGCAGG - Intergenic
1073073203 10:100807683-100807705 AGCACACCCGCTCCCACACAGGG + Intronic
1073097187 10:100987069-100987091 CCCGAGCCCGGCCCCACTCACGG + Exonic
1074095104 10:110304747-110304769 CCCGCCCCCAGCCCCACACAAGG - Exonic
1074465744 10:113679832-113679854 GCCCCGCCCGGCCCTACCCAGGG + Intronic
1075372471 10:121949667-121949689 ACCACCCCTGCCCCCACAAAGGG + Intergenic
1075488172 10:122844576-122844598 ACCACGCCCAGCCCCTTACCGGG - Intronic
1075554065 10:123416862-123416884 ATCACGCCAGCTCCCACACAAGG - Intergenic
1075758843 10:124839809-124839831 ACCTCGCCCGGCCCTGGACAAGG - Intergenic
1076883135 10:133249240-133249262 CCCACGCCCCTCCCCACTCAGGG - Intergenic
1077034447 11:488000-488022 GCCACGCCCGGCCCTGCCCACGG - Intronic
1077034469 11:488069-488091 GCCACGCCCGGCCCTGCCCACGG - Intronic
1077075839 11:701696-701718 ACCGCGCCCGGCCGGAGACAGGG + Intronic
1077109890 11:857690-857712 ACCACGCCCGGCCCCAGTTTGGG + Intronic
1077150537 11:1071155-1071177 TCCAACCCCAGCCCCACACAGGG - Intergenic
1077238323 11:1495602-1495624 ACCACGCCCGGCCTAACAAGAGG + Intronic
1077270770 11:1678635-1678657 ACCACGCCCGGCCCCAGGGAGGG + Intergenic
1077582510 11:3425621-3425643 ACCACGCCTGGCCTCACTGAAGG + Intergenic
1079644189 11:22843174-22843196 ACCATGCCTGGCCCAACAAAGGG - Intergenic
1079851621 11:25542931-25542953 ACCGCGCCCGGCCACATCCATGG - Intergenic
1080582867 11:33657920-33657942 AGCAGGCCTGGCCCCCCACAGGG - Intronic
1080634709 11:34113511-34113533 ACCGCGCCTGGCCCAACCCAAGG - Intronic
1081526366 11:43930387-43930409 ACCAGGCCCGGTCCAACACTGGG - Intronic
1081911140 11:46700676-46700698 CCCACTTCCGGCCCCAAACATGG + Intergenic
1082972821 11:59041820-59041842 ACCGCGCCCGGCCTAACACTTGG - Intronic
1083331181 11:61899077-61899099 ACCTCTCCCGGCCCCGCACAAGG - Intronic
1083569927 11:63754409-63754431 ACCGTGCCTGGCCCCACACTGGG - Intronic
1083843680 11:65318710-65318732 ACCGCGCCCGGCCTAACACCTGG + Intronic
1084200832 11:67557013-67557035 ACCACGCCTGGCCCAACAGTTGG + Intergenic
1084239420 11:67808444-67808466 ACCATGCCCGGCCTCACTGAAGG + Intergenic
1084833010 11:71784405-71784427 ACCATGCCCGGCCTCACTGAAGG - Intergenic
1085355673 11:75834523-75834545 ACTGCGCCCGGCCCCATGCATGG - Intronic
1085664852 11:78405386-78405408 ACCACGCCTGGCCAAGCACATGG + Intronic
1087365632 11:97215123-97215145 ACCTCGCCTGGCCTCACAGATGG + Intergenic
1090271973 11:125393020-125393042 ACCACGCCCGCCACCACGCCGGG - Intronic
1091476831 12:783358-783380 ACCACGCCCAGCCCCAAGTATGG - Intronic
1092155317 12:6278581-6278603 GCCACGCCCGGCCCCAGGAAAGG + Intergenic
1092410105 12:8246066-8246088 ACCATGCCCGGCCTCACTGAAGG + Intergenic
1092563358 12:9639147-9639169 ACCACGCCCGGCCTTCCCCAAGG + Intergenic
1092741407 12:11633707-11633729 ACCGCGCCCGGCCCCCAACATGG - Intergenic
1093028356 12:14265410-14265432 ACCACGCCCGGCCACACCAAAGG - Intergenic
1093563733 12:20577124-20577146 ACCACCCCCACCCCCAAACAAGG + Intronic
1096314357 12:50551132-50551154 ACCACGCCCGGCCTCAAATCTGG - Intronic
1097049037 12:56209744-56209766 ACCGCGCCCGGCCCCACACCTGG + Intronic
1098314050 12:69175295-69175317 ACCACACCCGGCCCCACTGTGGG - Intergenic
1098841399 12:75482560-75482582 ACCACGCACGGTGCTACACAAGG + Intronic
1100237163 12:92672509-92672531 ACCACGCCTGGCCTGCCACAGGG - Intergenic
1102289577 12:111688152-111688174 ACCGCGCCCGGCCCCCCCAAAGG + Intronic
1102644755 12:114396685-114396707 ACCACGCAGGACCCCACCCAAGG + Intronic
1102699283 12:114825217-114825239 ACCACACCCGGCCCCAGGGAAGG - Intergenic
1102939768 12:116929093-116929115 ACCGCGCCCGGCCCCATTGATGG + Intronic
1103281291 12:119759895-119759917 ACCGCGCCCGACCCCACATCAGG - Intronic
1103402640 12:120653820-120653842 ACCACGCCCGGCCCGCCTCTTGG + Intronic
1103572008 12:121851149-121851171 ACCGTGCCCAGCCCCACACCTGG + Intronic
1103597641 12:122033599-122033621 ACCACGCCCAGCCACACACCTGG + Intronic
1103653322 12:122450479-122450501 ACCGCGCCCGGCCTCTCTCATGG + Intergenic
1103837213 12:123831749-123831771 ACCACACCCGGCACCACACCCGG - Intronic
1104452623 12:128883300-128883322 ACTACGCCCGGCCCTAAACTTGG - Intronic
1104608270 12:130205643-130205665 CCCACACCCAGGCCCACACATGG + Intergenic
1105222280 13:18342582-18342604 ACCACACCCGGCCCATTACAAGG - Intergenic
1105759251 13:23498397-23498419 ACCGCGCCCGGCCCAATGCAAGG + Intergenic
1106148914 13:27079207-27079229 ACTCCCCCCCGCCCCACACAGGG - Intronic
1106250498 13:27978558-27978580 GCCCCGCCCGGCCCCAAAGAAGG + Intronic
1106500882 13:30327725-30327747 ACCGCGCCCAGCCACAAACACGG - Intergenic
1113494525 13:110715977-110715999 GCCACGCGCGGCCCCACCCTCGG - Exonic
1113815136 13:113164265-113164287 ACCGCGCCCGGCCTCACTCACGG + Intronic
1114743769 14:25124874-25124896 ACCGCGCCCGGCCTCAACCAAGG - Intergenic
1114885420 14:26843635-26843657 ACCGCGCCCGGCCCCTCATAAGG + Intergenic
1115592079 14:34874457-34874479 ACCCCCCGCGGCCCCGCACACGG + Intronic
1116659000 14:47683623-47683645 ACCATGCCAGGCCCCAAACCAGG - Intergenic
1116834579 14:49757843-49757865 ACCGCGCCCGGTGCCACACCTGG - Intergenic
1118616760 14:67579308-67579330 AGCACGCCCAGCTCCTCACATGG - Exonic
1118676052 14:68185661-68185683 ACCACCCCCGCCCCCATCCACGG - Intronic
1119328726 14:73778063-73778085 ACCACGCCTGGCCCCTATCATGG - Intronic
1119501166 14:75128427-75128449 ACCACGCCCGGCTAGGCACATGG - Intergenic
1119740946 14:77013417-77013439 ACCGCGCCCGGCCTACCACAGGG - Intergenic
1119801231 14:77447312-77447334 ACCGTGCCCGGCCGCACACCTGG + Intronic
1121346497 14:93139885-93139907 ACCGCGCCCTGCCCCTCACTTGG + Intergenic
1121710994 14:96039245-96039267 ACCACTCCCCGCCCCACCCCCGG - Intergenic
1122493667 14:102136922-102136944 ACCGCGCCCGGCCTCAAACCAGG - Intronic
1122586678 14:102812628-102812650 ACCACGCCCGGCCTGAGAAAAGG - Intronic
1122780181 14:104140167-104140189 ACCCTGCCCTGCCCCAGACAGGG - Intronic
1122808079 14:104270831-104270853 ACCGCGCCCGGCCGCACAGGGGG - Intergenic
1123110785 14:105866023-105866045 CCCCCGCCGGGCCCCACAGACGG - Intergenic
1124574418 15:30895588-30895610 ACTGCGCCTGGCCCCAAACAGGG - Intergenic
1125473508 15:40027599-40027621 ACCACGCCCGGCCACAAAATGGG - Intronic
1126901295 15:53317222-53317244 ACCATGCCCGCCACCACACCTGG - Intergenic
1127336179 15:57986942-57986964 ACCACGCCCGGCCACAGACAAGG + Intronic
1127915363 15:63450777-63450799 ACCGTGCCCGGCCCCACATGGGG + Intergenic
1129202001 15:74008447-74008469 ACCACGCCCGGCCCCATCAATGG - Intronic
1129320494 15:74772066-74772088 CCCGCGCCAGGCCCCACGCAAGG + Intergenic
1129372409 15:75105799-75105821 ACCATGCCCAGCCTCCCACATGG - Intronic
1129799149 15:78400539-78400561 ACCACGCCCAGCCTCAAATATGG - Intergenic
1130607999 15:85334953-85334975 ACCACGCCCGGCCCCGCACCTGG - Intergenic
1131752557 15:95525701-95525723 AGGACTTCCGGCCCCACACAAGG + Intergenic
1132289363 15:100688681-100688703 ACAAGGCCCCTCCCCACACAGGG - Intergenic
1132369057 15:101280566-101280588 ACCACGCCTGGCCAAACTCAGGG - Intergenic
1132568243 16:632927-632949 ACCACTGCCCGCCCCACACCTGG + Exonic
1132660123 16:1057613-1057635 ACCAAGCCCGACCTCACGCAGGG + Intergenic
1132729874 16:1356040-1356062 CCCTGGCCCGGCCCCACACCTGG - Intronic
1132975106 16:2707089-2707111 ACATCTCCAGGCCCCACACAGGG - Intronic
1132997395 16:2830344-2830366 ACCTTGCCGGGCCCCACCCATGG - Intronic
1133050339 16:3113871-3113893 ACCACGCACGCACACACACACGG - Intronic
1133334914 16:5000771-5000793 CCCAGGCCCGGCCCCAGGCACGG - Intronic
1133351090 16:5100859-5100881 ACCATGCCCGGCCTCACTGAAGG + Intergenic
1135378841 16:21975799-21975821 ACCACACCCGGCCAAACACATGG - Intronic
1136181858 16:28558401-28558423 ACCACGCCTGGCTGCACACCTGG + Intronic
1136927473 16:34388477-34388499 CCCGCGCCCGGTCCCACACTGGG - Intergenic
1136977101 16:35023329-35023351 CCCGCGCCCGGTCCCACACTGGG + Exonic
1138127308 16:54449285-54449307 ACCACGCCGGGCCCCAACAATGG + Intergenic
1138646821 16:58431690-58431712 ACCCCTCCCTACCCCACACACGG + Intergenic
1139298695 16:65925556-65925578 ACCACACCCGGCCCACCACCCGG - Intergenic
1139703384 16:68723778-68723800 ACCGCGCCCGGCCTCACACCCGG - Intergenic
1139714213 16:68799722-68799744 ACCACACCCGGCCCCAACCTTGG - Intronic
1139753240 16:69121956-69121978 ACCGCGCCCGGCCCTAGAGATGG + Intronic
1139778731 16:69333455-69333477 ACTGCGCCCGGCCCAATACATGG + Intronic
1140088607 16:71818686-71818708 ACCGCGCCCGGCCCCAAACCGGG + Intergenic
1141393580 16:83684943-83684965 GCCCCACACGGCCCCACACAGGG + Intronic
1141424854 16:83938260-83938282 ACCACGCCCGGCCCCAAGACTGG + Intronic
1142162039 16:88562625-88562647 ACCAGCCCCCGCCCCCCACAGGG - Intergenic
1142854118 17:2720619-2720641 ACCACGCCCGGCCCATCTGAGGG + Intergenic
1143011906 17:3870652-3870674 ACCACGCCCGGCCAAACCCCAGG + Intronic
1143031256 17:3968544-3968566 ACCATGCCCGGCCTCCCACTTGG + Intergenic
1143201470 17:5116293-5116315 ACCACTCCCGGCCCCGCTCCCGG + Intronic
1143753609 17:9050378-9050400 ACCACGCCTGGCCCCAGCTAGGG - Intronic
1144639402 17:16929268-16929290 CCCACGCCTGGCCTCACACCAGG + Intergenic
1145205445 17:20982751-20982773 ACCACGCCCGGCCCCAACTATGG - Intergenic
1146909806 17:36641469-36641491 CCCAGGCCCGGCTCCACTCATGG - Intergenic
1147473531 17:40686987-40687009 ACCGCGCTGGGCCCCACTCAGGG + Intergenic
1147654702 17:42082234-42082256 ACCAAGCCCAGCACCTCACAGGG + Intergenic
1147939578 17:44036830-44036852 ACCACGCCTGGCCCCATATTGGG - Intronic
1150072596 17:62164421-62164443 ACCTCGCCCGGCCCCTCCAAAGG - Intergenic
1150134936 17:62690313-62690335 ACCAGGCCAGAGCCCACACATGG + Intronic
1150244359 17:63662962-63662984 ACCACGCCCGGCCCCAGAAGAGG + Intronic
1150377484 17:64693881-64693903 ACCACACCCGCCACCACACCCGG - Intergenic
1151621493 17:75248180-75248202 ACCACGCCCGGCCCCGTAGCTGG - Intronic
1151693671 17:75703031-75703053 ACCACACTCAGACCCACACAAGG - Intronic
1151720166 17:75850532-75850554 ACCGCACCCGGCCCCAGCCAGGG + Intronic
1151740756 17:75980045-75980067 ACCGCGCCCGGCCCTACACTAGG - Intronic
1151971349 17:77459056-77459078 GCCACGGTCGGCCCCACACGTGG + Intronic
1152022019 17:77784920-77784942 ACCACACCCGGCCACAAGCAAGG + Intergenic
1152423634 17:80207259-80207281 ACCACGCCCGGCCAAAATCAGGG - Intronic
1152901163 17:82941829-82941851 CCCAGCCCCGGCCCCACTCATGG - Intronic
1153964424 18:10166997-10167019 ATCAGGCCCGGCCCCACCCCTGG + Intergenic
1154437319 18:14357018-14357040 ACCACGCCCAGCCCCTCAGTAGG - Intergenic
1155728328 18:29118214-29118236 ACCACGCCCGGCCTTACAACAGG - Intergenic
1155965606 18:32032700-32032722 ACCAAGCCCGGCCCTCCACTGGG - Intronic
1157481221 18:48055114-48055136 ACCATGCCCAGCCCCACATTAGG - Intronic
1157601656 18:48896838-48896860 ACAGGGCCCGGCACCACACATGG - Intergenic
1157676421 18:49572018-49572040 GCCACGCCCGGCCACACATGAGG - Intronic
1158226408 18:55205947-55205969 ACCACACCTGGCTCAACACAGGG + Intergenic
1160452038 18:78973011-78973033 GCCACCCCCGCCCCCACACTCGG + Intergenic
1160729870 19:636689-636711 ACCACGCCCGGCCAGATATATGG - Intergenic
1160741610 19:688886-688908 ACCACGCCCGGCCCCACACAGGG + Intronic
1161018763 19:1997681-1997703 ACCATGCCCTGGGCCACACAGGG + Intronic
1161102637 19:2428903-2428925 ACCACCCCCAGCTCCACCCAAGG + Exonic
1161376014 19:3939232-3939254 ACCACGCCTGGCTCCAGACTTGG - Intronic
1161390035 19:4015973-4015995 GCCAGCCCCGTCCCCACACACGG - Intronic
1161507322 19:4650827-4650849 ACCACACCTGGCCCCCGACAGGG - Intronic
1161685548 19:5701022-5701044 ACCGCGCTCAGCCCCACACATGG - Intronic
1162176209 19:8832278-8832300 CCCACGCGCGGCCCCTCCCACGG + Exonic
1162518006 19:11161420-11161442 ACCACGCCCGGCCAGAGACAGGG + Intergenic
1162780223 19:13002795-13002817 ACCACCCCCGGCTCCCCTCAGGG - Intronic
1162906401 19:13826476-13826498 ACCACACCCGGGCTCATACAGGG - Intronic
1163337574 19:16683297-16683319 ACCACACCCAGCCCCCAACAAGG - Intronic
1163828229 19:19535580-19535602 ACCTCGCCCGGCTCCACGCCGGG - Exonic
1164224086 19:23226338-23226360 ACCACGCCCAGCCCGAGAGAGGG + Intronic
1164758961 19:30713746-30713768 ACCACGCCCTGCCCAGTACAGGG - Intergenic
1165280412 19:34792572-34792594 ACCGCACCTGGCCCCTCACAAGG - Intergenic
1165813905 19:38629581-38629603 ACCACGCCCGGCCACAAATCTGG + Intronic
1166136694 19:40781730-40781752 ACCACGCCCGGCCTCTCCTAAGG - Intronic
1167269610 19:48499596-48499618 ACCCCGGCCGGCCCCACGCCGGG + Exonic
1167355726 19:49002872-49002894 ACTGCGCCCGGCCCCAGCCAGGG + Intronic
1168046138 19:53795661-53795683 ACCGCGCCCGGCCTCAGACAAGG + Intronic
925024876 2:599778-599800 AACACTCCCTACCCCACACATGG - Intergenic
925783050 2:7401101-7401123 GCCAGGCCCAGCCACACACAAGG - Intergenic
926308379 2:11656925-11656947 AGCACGCCCGGCCCCGCAGCCGG - Intergenic
927717683 2:25363078-25363100 ACCGCGCCTGGCCCCAGAGATGG - Intergenic
928614932 2:33028378-33028400 ACCACGCTAGGCCTCTCACATGG - Intronic
933039181 2:77440123-77440145 ACCGCGCCCGGCCTCACACACGG - Intronic
933727536 2:85435252-85435274 ACCCCGCCGTGCCCCAGACAGGG + Intronic
934961434 2:98679021-98679043 ACCACGCCTGGCCACTCACTGGG - Intronic
936388550 2:112053014-112053036 ACCGCGCCCGGCCCCAATGATGG - Intergenic
936407553 2:112220530-112220552 ACCGCGCCCAGCCCTACAAAGGG - Intronic
937390676 2:121483172-121483194 CCCCCTCCCCGCCCCACACAGGG + Intronic
938227070 2:129625434-129625456 ACCACGCCCGGCCCCATTAAAGG + Intergenic
940918853 2:159286426-159286448 ACCACGCCTCGCCGCACTCAAGG + Exonic
942350767 2:175050644-175050666 ACCACGCCCGGCCCATAATAAGG + Intergenic
943797247 2:192012039-192012061 ACCTCGCCCGGCCCACCACCAGG + Intronic
943989013 2:194661451-194661473 ACCACCCCCGACCTCAAACATGG - Intergenic
944578534 2:201112957-201112979 ACCACACCCAGCCCCAAAGAGGG - Intergenic
945295600 2:208168382-208168404 ACCGCGCCCGGCCCAACTCTTGG - Intronic
946219904 2:218217361-218217383 ACCCCACCCAGCCCCACTCAGGG + Exonic
947166229 2:227264668-227264690 ACCACACCTGGCCCCAGAAAAGG - Intronic
947606484 2:231489398-231489420 ACCACGCTAGGCCCCACCTATGG + Intergenic
948145153 2:235703215-235703237 ACCACGCCCGGCCCGAGCCACGG + Intronic
948894316 2:240921270-240921292 ATCACGCCCTGACCCCCACACGG + Intronic
1168986108 20:2050375-2050397 ACTGCGCCCGGCCCCACACAGGG + Intergenic
1170070984 20:12367191-12367213 ACCTCGCCCGGCCCAATAAATGG + Intergenic
1170916855 20:20634857-20634879 AGCACAACAGGCCCCACACAAGG + Intronic
1171494903 20:25548733-25548755 CCCACACCCGGCCTCACCCAGGG + Intronic
1171563262 20:26149585-26149607 ACCGCGCCCGGCCCCTAAAATGG - Intergenic
1172175309 20:32968646-32968668 ACCGCACCCGGCCCCACATAGGG + Intergenic
1173807073 20:45933166-45933188 ACCACGCCCGGCCCAAAGCAGGG + Intergenic
1173889916 20:46498883-46498905 ACCGCGCCCGGCCCTTCACATGG - Intergenic
1174356706 20:50003172-50003194 ACCACACCCGGCCCTGCACCAGG + Intergenic
1175153844 20:56955942-56955964 ACCACGCCCGGCCTCAGACTCGG + Intergenic
1175758250 20:61544035-61544057 CACACCCCCGGCCCCACACCTGG + Intronic
1176263797 20:64197994-64198016 ACCGCGCCCGGCCCAGCAGAAGG - Intronic
1176730828 21:10495005-10495027 ACCACACCCGGCCCATTACAAGG - Intergenic
1176839733 21:13828620-13828642 ACCACGCCCAGCCCCTCAGTAGG + Intergenic
1178557317 21:33604076-33604098 ACCACGCCCGGCCAGAGACGGGG - Intronic
1178920212 21:36733848-36733870 ACCATGCCCGGCCCGAAGCAGGG + Intronic
1179992211 21:44953936-44953958 ACCACCGCCGTCCCCATACATGG - Intronic
1181095142 22:20499795-20499817 ACCACGCCCGGCCAAAGAGAAGG + Intronic
1181378898 22:22483555-22483577 ACCACACCTGGCCCCAAAAATGG + Intergenic
1182295886 22:29311112-29311134 GCCAGGCCCGCCCCCACCCACGG - Intronic
1182384905 22:29929799-29929821 ACCGCGCCCGGCCTCATAGAAGG + Intronic
1182858381 22:33537858-33537880 ACCATGCCTGGCCCTATACAGGG + Intronic
1183302935 22:37067179-37067201 ACCGTGCCCGGCCCTCCACATGG - Intronic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1184132682 22:42526865-42526887 ACCGCGCCCGGCCCAGCAGAGGG + Intergenic
1184225181 22:43125561-43125583 CCCACCCCCGGCCCCATACCTGG - Intronic
1184587161 22:45455758-45455780 ACCACCCCCGCCCCCATGCAGGG + Intergenic
1184771227 22:46597776-46597798 ACCACGCCCGGCCTCTGGCATGG + Intronic
1184965043 22:47965513-47965535 ACTACACCAGGCCCCACACTGGG - Intergenic
1185014290 22:48334272-48334294 GCCACGCCTGGCTCCTCACAGGG + Intergenic
1185333280 22:50261049-50261071 CCCCCGCCCGGCCCCACAGCAGG + Intronic
1185381163 22:50508018-50508040 ACCCCGCCCCGCCCGACCCACGG + Intergenic
950258030 3:11521839-11521861 ACCACGCCCGGCCCCAGCCCAGG + Intronic
951556787 3:23929070-23929092 ACCACGCCTGGCACAAAACATGG - Intronic
953448867 3:42990037-42990059 ACCACACCTGGCCCTGCACAGGG - Intronic
953470175 3:43159592-43159614 GCCACCCATGGCCCCACACATGG + Intergenic
953915998 3:46921603-46921625 AACATGCCCAGCCCAACACAGGG + Intergenic
954206693 3:49064540-49064562 ACCACGCCTGGCCCAAAACTAGG + Intronic
958785721 3:98594183-98594205 ACCGCGCCCGGCCCCAGCCTGGG - Intergenic
961299478 3:125913465-125913487 ACCATGCCCGGCCTCACTGAAGG - Intergenic
961417566 3:126771496-126771518 ACCACGCCTGGCCCCCTAAAGGG + Intronic
961566031 3:127763790-127763812 ACCTCCCCCTCCCCCACACAGGG - Intronic
963240791 3:143000628-143000650 ACCACGTCCCTCCCCACACCTGG + Intronic
963895737 3:150683473-150683495 ACCATGCCCGGCCTCCCTCATGG - Intronic
964835800 3:160937329-160937351 ACCACGCCTGGCCTCTTACATGG - Intronic
965618812 3:170622078-170622100 ACCACGCCCGGCCCAAAGCAGGG - Intronic
967125916 3:186424712-186424734 ACCACGCCCGGCCCAACCACCGG - Intergenic
967313718 3:188130842-188130864 ACCATGCCCAGCCTCATACATGG - Intergenic
968211367 3:196851477-196851499 ACCACACCCAGCCCTAGACAGGG + Intergenic
968227258 3:196981081-196981103 ACCACGCCTGGCCTCATATAAGG - Intergenic
968998156 4:3958500-3958522 ACCATGCCCGGCCTCACTGAAGG + Intergenic
969397391 4:6931186-6931208 ACCACGCCCGGCCTCACTCTGGG + Intronic
969755848 4:9150160-9150182 ACCACGCCCAGCCTCACTAAAGG - Intergenic
969762016 4:9193359-9193381 ACCGCGCCCGGCCCCACTAATGG - Intergenic
970019983 4:11557293-11557315 ACCGTGCCCGGCCCCTCATAAGG + Intergenic
971337482 4:25737270-25737292 ACCACGCCCAGCCTCAGACTAGG + Intergenic
971823193 4:31586315-31586337 ACCACCCCCGGCCCCATCCTGGG - Intergenic
971906473 4:32732553-32732575 ACCACACCCCACCCCACGCAGGG - Intergenic
972335615 4:38105042-38105064 ACCACACCCGGCCCCACTTAAGG + Intronic
973628625 4:52797586-52797608 ACCGCGCCTGGCCGCACCCAAGG - Intergenic
975883842 4:78941307-78941329 ACCACGCCCGGCCCCTTACTAGG + Intergenic
976185785 4:82441477-82441499 ACCACGCCTGCCACCACACCCGG - Intronic
977136123 4:93306906-93306928 ACCGCGCCTGGCCCCACAGTAGG - Intronic
981027834 4:140094459-140094481 ACCATGGCCAGCCACACACAGGG + Intronic
981308743 4:143274787-143274809 ACCGCGCCCGGCCGAACCCATGG - Intergenic
982678825 4:158406060-158406082 ACCACGCCCGGCTGAAGACATGG + Intronic
982765100 4:159337598-159337620 ACCACGCCCGGCCAAACCTATGG - Intronic
983218536 4:165022889-165022911 ACCGTGCCCGGCCCCACATCAGG + Intergenic
984264483 4:177480802-177480824 ACCACGCTCAGCCCAACATATGG + Intergenic
987107811 5:14658146-14658168 GCCACGCCCGGCCAAACACTAGG - Intergenic
987620105 5:20329471-20329493 ACCATGCCCGGCCCCATTTAAGG - Intronic
987901914 5:24023450-24023472 GCCACGCCAAGCCCCACCCAAGG + Intronic
988666659 5:33336148-33336170 ACCATGCCCGGCCCCTTAAATGG + Intergenic
989374559 5:40747345-40747367 ACCACGCCCGGCCCAAAACTTGG + Intronic
989612971 5:43313181-43313203 CCCCCGCCCGGCCCCGCTCACGG + Intronic
990949022 5:61278056-61278078 ACCACGCCCAGCCTCAAATAAGG - Intergenic
991077364 5:62555790-62555812 ACTGCGCCTGGCCCCACACCTGG + Intronic
991769607 5:70028263-70028285 ACCGCGCCCGGCCACACACTTGG - Intronic
991848902 5:70903681-70903703 ACCGCGCCCGGCCACACACTTGG - Intronic
994166590 5:96615585-96615607 ACCACGCCAGGCCCCAGGGAAGG + Intronic
994366597 5:98924684-98924706 ACCACGCCAGGCCTGACACTTGG - Intronic
994551473 5:101239839-101239861 ACCACCCCCTGACCCTCACAGGG - Intergenic
995675879 5:114661916-114661938 ACCACGCCTGGCCTTACAAATGG + Intergenic
998252912 5:140564494-140564516 GCCTCCCCCGGACCCACACACGG - Intronic
999293982 5:150446532-150446554 ACCAGCCTCGGTCCCACACAAGG + Intronic
1000786097 5:165545706-165545728 ACCACGCCCGGCCTCATAATAGG - Intergenic
1001422171 5:171596396-171596418 CCCACCCCCGGCCCCATCCAGGG + Intergenic
1001870596 5:175151055-175151077 ACCACGCCCAGCCCCACTCCTGG + Intergenic
1002020893 5:176363982-176364004 ACCACGCCCGGCTCCACGCCCGG + Intergenic
1002039776 5:176504292-176504314 ACCAAGCCCGGCCAGAGACAGGG - Intronic
1002186488 5:177457079-177457101 CCCACGCCAGGCCCCAAGCAGGG + Exonic
1002366509 5:178716787-178716809 ACCACGCCCGGCCCCGTTCCAGG - Intronic
1002417308 5:179127258-179127280 GGCACCCCCGGCCCCACACCGGG - Intronic
1002552637 5:180007771-180007793 ATCAGCCCCGGCCCCACACTGGG + Intronic
1002602596 5:180362467-180362489 ACCCCGCCTGGCCCCAAACTTGG - Intergenic
1002721429 5:181263452-181263474 ACTACGCTCAGCCCCATACAAGG + Intergenic
1003427542 6:6007637-6007659 CCCATGCCCGCCCGCACACAAGG + Intergenic
1003686227 6:8305380-8305402 ACCACGCCCCCACCAACACATGG - Intergenic
1004262863 6:14123386-14123408 ACCACGCCCGGCCTCACTGAAGG + Intronic
1004640863 6:17514072-17514094 ACCGCGCCTGGCCCTCCACATGG - Intronic
1006983916 6:38165603-38165625 ACCGCACCCGGCCCCACTCCTGG + Intergenic
1007269798 6:40627788-40627810 ACCGCGCCCGGCCCAAAGCATGG - Intergenic
1007579796 6:42950948-42950970 ACCATGCCCGGCCCCAATCCAGG + Intergenic
1008059680 6:46984362-46984384 ACCACGCCCCACCCAACAAAGGG + Intergenic
1015936665 6:138411666-138411688 ACCACGCCCGGCCTCTGAGAAGG - Intronic
1017103956 6:150870621-150870643 ACCACGCCCGGCCTTATATATGG - Intronic
1017816855 6:158022340-158022362 ACCACCCCAGGCCTCCCACAAGG - Intronic
1018024779 6:159796189-159796211 ACCATGCCCAGCCCCTCATATGG - Intronic
1018283804 6:162216239-162216261 ACCGCGCCCGGCCGCAAACTGGG - Intronic
1018309418 6:162492660-162492682 ACCGCGCCCGGCCCCACACCTGG - Intronic
1019035325 6:169050065-169050087 ACCACGCCTGGCCCCACATCAGG + Intergenic
1019325551 7:436591-436613 GCCACGCCAGGCCCCACCCCGGG - Intergenic
1019337829 7:493730-493752 CCCACCCCAGGCCCCACACCTGG + Intergenic
1019376385 7:694744-694766 ACCATGCCCGGCCCTTCACCTGG - Intronic
1019634712 7:2069391-2069413 ACCAAGCCCCGCCCCACCCCAGG + Intronic
1020098635 7:5382243-5382265 AACATACACGGCCCCACACAGGG + Intronic
1020886145 7:13821063-13821085 ACCGCGCCCGGCCCTACAAAGGG + Intergenic
1021395563 7:20143676-20143698 ACCACGCCCAGCCCTACATTTGG + Intronic
1022532782 7:31077165-31077187 ACCACTCCCGGCCCCCTGCAAGG + Intronic
1023041920 7:36179966-36179988 ACCCACCCCGGCCCCACTCAGGG - Intronic
1024359760 7:48455594-48455616 AGCACGCCCTGCCCCACAGGAGG + Intronic
1025952626 7:66157506-66157528 ACCACACCTGGCCCCAGACAAGG - Intergenic
1026099996 7:67376949-67376971 ACCACGCCCAGCCACATACTTGG - Intergenic
1026177487 7:68010557-68010579 ACCACGCCTGGCCCGACAGGAGG + Intergenic
1026376025 7:69752057-69752079 TCCACCCCCCGCCCCACACCCGG + Intronic
1026954893 7:74370956-74370978 ACCACGCCTGGCCCCTCAACGGG - Intronic
1027003199 7:74669022-74669044 ACCACGCCCGGCCCAAAAGAAGG + Intronic
1027146767 7:75700992-75701014 ACCACACCCGGCCCCTGACCCGG + Intronic
1028552826 7:92090333-92090355 ACCGTGCCTGGCCCTACACAGGG - Intronic
1028634011 7:92966995-92967017 ACCACGCCCAGCCACATGCATGG - Intergenic
1029656499 7:101928651-101928673 ACCACACCCGGCCTCACAAATGG + Intronic
1029935569 7:104420849-104420871 ACCGCGCCCGGCCCCCCAAAGGG + Intronic
1029990909 7:104961817-104961839 ACCGCGCCCGGCTCCAGACTGGG + Intergenic
1031594036 7:123627020-123627042 ACCATGCCCAGCCCCACAACAGG + Intronic
1033301035 7:140185878-140185900 ACCACGCCCGGCCTCCCACCAGG - Intergenic
1035339620 7:158151882-158151904 ACCGCGCCCGGCCGCATTCATGG - Intronic
1035897630 8:3421925-3421947 ACGGCGCCCGGCCCCACAGATGG + Intronic
1035897638 8:3421963-3421985 ACCACAACCGGCCCCACAGATGG + Intronic
1036379087 8:8225461-8225483 ACCACGCCCGGCCTCACTGAAGG - Intergenic
1036850475 8:12197150-12197172 ACCACGCCCGGCCTCACTGAAGG + Intergenic
1036871840 8:12439423-12439445 ACCACGCCCGGCCTCACTGAAGG + Intergenic
1038326615 8:26577277-26577299 GCCACGCCCGGCCCCGGAGAGGG - Intronic
1038414486 8:27384137-27384159 ACCATGACCGGCCCAACACCTGG + Intronic
1040532199 8:48275182-48275204 ACCATGCCTGTCCCCATACATGG + Intergenic
1041259130 8:56005071-56005093 ACCACGCCCGGCCAGCCACATGG + Intronic
1042349993 8:67767328-67767350 ACCGCGCCCGGCCCAAACCATGG + Intergenic
1043743560 8:83844509-83844531 ACCGCGCCCAGCCCCACAACAGG + Intergenic
1045741047 8:105359661-105359683 ACCGCGCCCGGCCCCACTCTGGG + Intronic
1046937441 8:119898431-119898453 ACCACACCCAGCCCAATACAAGG - Intronic
1049470417 8:142772849-142772871 ACCTGTCCCAGCCCCACACATGG - Intronic
1049612150 8:143560790-143560812 GCCACGCCTGGCCCCCCACGTGG + Intronic
1049628593 8:143638439-143638461 ACCACGGCCGGCCAGAAACAGGG - Intronic
1049933257 9:476229-476251 ACCACGCCCGGCCTAACACCTGG - Intronic
1051146108 9:14029311-14029333 ACCACGCCCGGCTGAAAACATGG - Intergenic
1053019707 9:34686414-34686436 ACCATGCCCCGCCCCCCACCAGG - Intergenic
1053215967 9:36270804-36270826 ACCACGCCCGGCCTGACAGGAGG + Intronic
1055182275 9:73402507-73402529 GCCAGGGCCGGCCCCACCCAAGG - Intergenic
1056163733 9:83922415-83922437 ACCACGCCCGGCCCTTTAGATGG + Intergenic
1056257640 9:84816489-84816511 GCCACGCCCAGCCCAACACTGGG - Intronic
1056601516 9:88050714-88050736 ACCATGCCCAGCCCCCCAAATGG + Intergenic
1056759047 9:89402056-89402078 ACCACACCCAGCCCCACTCATGG - Intronic
1057035870 9:91811321-91811343 AGCACCCCCGGCCACACAAAAGG - Intronic
1057142748 9:92737487-92737509 CCCACGCGCTGCCCCACACTGGG - Intronic
1057168840 9:92948789-92948811 ACCACCCCTGCCCCAACACAAGG - Intronic
1058173884 9:101715365-101715387 ACCATGCCCGGCCTTAAACATGG - Intronic
1059452907 9:114381936-114381958 ACCATGCCCGGCCCCCTCCAGGG + Intronic
1059860248 9:118452416-118452438 ACCGCGCCCGGCCCAAGATATGG - Intergenic
1059960982 9:119564328-119564350 ACCACGCCTGGCCCCACTGATGG - Intergenic
1060776036 9:126375545-126375567 AGCACGCCCAGGCCCAGACAGGG - Intronic
1061053929 9:128211795-128211817 ACAAAGCCCCACCCCACACAGGG - Intronic
1061721034 9:132551583-132551605 ACCACGCCCGGCCCAAGCCTGGG + Intronic
1062359572 9:136181344-136181366 ACCGCGCCCGGCCAAAAACATGG - Intergenic
1062538991 9:137033177-137033199 GCCACGCCTGGGACCACACAAGG - Exonic
1062687709 9:137823698-137823720 ACCACGCCCGGCCCAACGCCTGG + Intronic
1203625734 Un_KI270750v1:18611-18633 ACCGCGCCCGGCCCCTAAAATGG + Intergenic
1185890690 X:3819380-3819402 ACCGCGCCCGGCCTCCCTCAAGG - Intronic
1188011684 X:25062971-25062993 ACCACGCCCGGCCACAAATGGGG - Intergenic
1189799996 X:44683353-44683375 ATCACGCCCGGCCTCACACCTGG - Intergenic
1190055265 X:47177904-47177926 ACCACGCCCAGCCCAAAACCAGG + Intronic
1190875622 X:54458257-54458279 ACCACGCCCAGCCTCACCAAGGG - Intronic
1192424828 X:71066298-71066320 ACCACGCCTGGCCCTACTCCAGG - Intronic
1192426624 X:71082861-71082883 ACCACGCCCGGCCCAAAAAGTGG + Intergenic
1192767085 X:74151732-74151754 ACCACGCCCGGCCGCATGTAGGG - Intergenic
1193618637 X:83722582-83722604 ACCGCACCCGGCCTCATACAAGG + Intergenic
1194467915 X:94255885-94255907 ACCAAGCATGGCCCCAGACATGG + Intergenic
1195324029 X:103743592-103743614 ACCGCGCCCGGCCTCACCCAGGG + Intergenic
1201764845 Y:17566872-17566894 ACCACCCCGGCCCCAACACAGGG + Intergenic
1201836707 Y:18339117-18339139 ACCACCCCGGCCCCAACACAGGG - Intergenic