ID: 1160744120

View in Genome Browser
Species Human (GRCh38)
Location 19:702661-702683
Sequence TCTTCACTGCTGAGTCCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160744120_1160744124 5 Left 1160744120 19:702661-702683 CCTTGGGGACTCAGCAGTGAAGA No data
Right 1160744124 19:702689-702711 GGCAAGTTCCTGCCCTTGTGGGG No data
1160744120_1160744129 28 Left 1160744120 19:702661-702683 CCTTGGGGACTCAGCAGTGAAGA No data
Right 1160744129 19:702712-702734 CTGACATTCAGCAGAGAGGCAGG No data
1160744120_1160744123 4 Left 1160744120 19:702661-702683 CCTTGGGGACTCAGCAGTGAAGA No data
Right 1160744123 19:702688-702710 AGGCAAGTTCCTGCCCTTGTGGG No data
1160744120_1160744128 24 Left 1160744120 19:702661-702683 CCTTGGGGACTCAGCAGTGAAGA No data
Right 1160744128 19:702708-702730 GGGGCTGACATTCAGCAGAGAGG No data
1160744120_1160744122 3 Left 1160744120 19:702661-702683 CCTTGGGGACTCAGCAGTGAAGA No data
Right 1160744122 19:702687-702709 CAGGCAAGTTCCTGCCCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160744120 Original CRISPR TCTTCACTGCTGAGTCCCCA AGG (reversed) Intergenic
No off target data available for this crispr