ID: 1160744123

View in Genome Browser
Species Human (GRCh38)
Location 19:702688-702710
Sequence AGGCAAGTTCCTGCCCTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160744120_1160744123 4 Left 1160744120 19:702661-702683 CCTTGGGGACTCAGCAGTGAAGA No data
Right 1160744123 19:702688-702710 AGGCAAGTTCCTGCCCTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160744123 Original CRISPR AGGCAAGTTCCTGCCCTTGT GGG Intergenic
No off target data available for this crispr