ID: 1160745407

View in Genome Browser
Species Human (GRCh38)
Location 19:709027-709049
Sequence GGCCGGGGCGGGCTAAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 484
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 449}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160745407 Original CRISPR GGCCGGGGCGGGCTAAGGCC TGG (reversed) Intergenic
900114097 1:1021169-1021191 GGCCGGTGCGGGCTACAGCTGGG + Intronic
900121819 1:1051539-1051561 GGCAGGGGTGGCCTGAGGCCCGG - Exonic
900169948 1:1262253-1262275 GGCCGTGGTGAGATAAGGCCCGG - Intronic
900180155 1:1307730-1307752 CGCCGGGGTGGGCGCAGGCCGGG - Intronic
900237409 1:1599352-1599374 GGCCGGGGCGCGCGAGGGCCGGG + Exonic
900284859 1:1894231-1894253 GGCCAGGGCGGGCACTGGCCTGG - Intergenic
900307728 1:2019278-2019300 GGCTGGGGCGGGCTCGGGGCGGG + Intergenic
900307755 1:2019401-2019423 GGCCGCGGCGGGCTCGGGACGGG - Exonic
900991452 1:6100153-6100175 GTCCTGGCCGGGCCAAGGCCTGG + Exonic
901055057 1:6445477-6445499 GGCTGGGGCAGGGTAGGGCCAGG + Intronic
901642830 1:10701735-10701757 GGCCGGGACGGACTGGGGCCAGG + Intronic
902613069 1:17608402-17608424 GGACTGCGCGGGCTGAGGCCTGG - Intronic
904009973 1:27383779-27383801 GGCAGGGGCCAGCTAGGGCCCGG - Intergenic
904563346 1:31413178-31413200 GGCCGGGGAGGGGCCAGGCCCGG + Intronic
904690828 1:32292236-32292258 GGCGGGGGCGGGGCCAGGCCGGG + Intronic
905035926 1:34918403-34918425 GGCAGGGGTGGGCCAAGGCCTGG - Intronic
906532825 1:46533221-46533243 GGCCGCGGCGGGCCCGGGCCAGG - Intergenic
907051090 1:51330383-51330405 GGGCGGCGCGGGCTGGGGCCCGG - Intronic
907278134 1:53328093-53328115 CGGCGGGGCGGGCTCAGGCTGGG + Intergenic
907430237 1:54406948-54406970 GGGCGGGGCGGGCTGGGGGCCGG - Intronic
907962935 1:59299303-59299325 GGCTGGGGAGGGTGAAGGCCAGG + Intronic
908477756 1:64505840-64505862 GGGCGGGGCGGGGCGAGGCCGGG - Intronic
912354314 1:109042290-109042312 GGGCGGGGCGGACCAAAGCCTGG + Intergenic
912354322 1:109042311-109042333 GGGCGGGGCGGACCAAAGCCTGG + Intergenic
912430145 1:109624582-109624604 TGGAGGGGCAGGCTAAGGCCAGG + Intronic
912547424 1:110460953-110460975 GGCCGGGGTGGGCTAGAGCCTGG + Intergenic
912793973 1:112679196-112679218 AGCAGGGGCGGCCTAAGGCAGGG + Intronic
912798617 1:112707211-112707233 GGCCGGGGCGGGCCGAGCCAAGG - Intronic
913957312 1:143318172-143318194 GGCCAGGGCAGGGCAAGGCCAGG + Intergenic
913957407 1:143318485-143318507 GGCCAGGGCAGGGCAAGGCCAGG + Intergenic
914051626 1:144143536-144143558 GGCCAGGGCAGGGCAAGGCCAGG + Intergenic
914051721 1:144143849-144143871 GGCCAGGGCAGGGCAAGGCCAGG + Intergenic
914127476 1:144822692-144822714 GGCCAGGGCAGGGCAAGGCCAGG - Intergenic
914127571 1:144823005-144823027 GGCCAGGGCAGGGCAAGGCCAGG - Intergenic
914490907 1:148149608-148149630 GGCCGGCGCGGGGTGAGGTCCGG - Intronic
914777302 1:150749563-150749585 GGGCGGGGCGGGGTGAGGCGGGG - Intronic
914845859 1:151283065-151283087 GGCCTGGCCTGGCTGAGGCCCGG + Intronic
915345561 1:155195249-155195271 GGCCGGGGGGGCCGGAGGCCGGG - Intergenic
916026390 1:160837158-160837180 GGCCAGAGAGGGCTGAGGCCAGG + Intronic
917291566 1:173477158-173477180 GGCCGGGCCGGGCTGGGGCCGGG - Intergenic
919101833 1:193105459-193105481 GGACGGGGCGGGGCAAGGCGGGG - Intronic
919880758 1:201899187-201899209 GGGCGGGGCTGGGTAGGGCCTGG - Intronic
920184586 1:204152076-204152098 GGCCGGGGCGGGGGCGGGCCGGG - Intergenic
921054193 1:211531793-211531815 GGCTGGGGTGAGCAAAGGCCTGG + Intergenic
921206774 1:212856232-212856254 GGCCGGGGCGGGCGGAGGGGGGG + Intergenic
921389629 1:214605611-214605633 GGCCGGCGCGGGGTGAGGTCCGG + Intronic
922699700 1:227751547-227751569 GACCGGCGTGGGCAAAGGCCAGG - Intronic
924188221 1:241519291-241519313 GTCCGTGGCGGGCCGAGGCCGGG - Intronic
924524577 1:244835204-244835226 GGCTGGGGCGGGCTGGGGGCTGG + Intergenic
924638236 1:245808988-245809010 GGCCGAGGCGGGCGGAGGTCAGG - Intronic
924775196 1:247111434-247111456 GGCCCGGGCGGGCGCAGGGCCGG + Exonic
1062873940 10:931111-931133 GGCCGGGGCAGGGGAAGGCCGGG - Intronic
1062874004 10:931270-931292 GGCCGGGGCAGGGGAAGGCCGGG - Intronic
1065526075 10:26622509-26622531 GGCAGGGGCGCGCGGAGGCCAGG - Intergenic
1066759523 10:38739112-38739134 GGCCGGGGCAGGGCAAGGGCTGG - Intergenic
1066760251 10:38742087-38742109 GGCCAGGGCAGGGCAAGGCCAGG - Intergenic
1069508223 10:69020652-69020674 GGCCGAGGCGGGCAGAGGTCAGG + Intergenic
1069644425 10:69982303-69982325 GGCCGAGGCAGGCTGAGGCCAGG + Intergenic
1069889932 10:71646361-71646383 GGCTGGGGCCGGCAAAGGCATGG + Intronic
1070152227 10:73811852-73811874 AGCAGGGGCGGGCTCAGGCCTGG + Intergenic
1070259545 10:74841336-74841358 GGCCGAGGTGGGCTGAGGTCAGG + Intronic
1071498589 10:86188009-86188031 GGCAGGGCAGGGCAAAGGCCTGG - Intronic
1073076805 10:100829426-100829448 GCCCCGGGCGGCCGAAGGCCGGG + Exonic
1073099592 10:100999765-100999787 GGCGGGGGCTGGCCAGGGCCGGG + Exonic
1073288767 10:102403126-102403148 GGCCGGCCCGGGCTCAGGCAGGG + Exonic
1074115390 10:110454102-110454124 GGCCGGGGGGAACTGAGGCCAGG + Intergenic
1074400738 10:113139429-113139451 GGGCGGGGCAGGCCATGGCCAGG - Intronic
1074829881 10:117241008-117241030 GGCGCGGGCGGGCGGAGGCCGGG + Intergenic
1075031893 10:119029616-119029638 GGCCGGGGCGGGGGAACGCAGGG + Intergenic
1075144604 10:119872594-119872616 GGCCGGGGCCGGCGAAGACCGGG + Exonic
1076136353 10:128047626-128047648 GGCTGAGCCGCGCTAAGGCCTGG - Intronic
1076372295 10:129963581-129963603 GGCCGGGCCGGGCCGGGGCCGGG + Intronic
1076650325 10:131982535-131982557 CGGCGGGGCGGGCAAAGACCCGG - Intergenic
1076722211 10:132397573-132397595 GGCCGGGGCGGGCCGGGGCGGGG + Intronic
1076733270 10:132448603-132448625 GGCCGGGCAGGGCTGAGGCAAGG - Exonic
1076864531 10:133160357-133160379 GGCGGGGGCGGGCGAGGGCCGGG + Intergenic
1076948303 10:133665974-133665996 GTCCGGCGCGGGCTGAGGGCTGG + Intergenic
1076949292 10:133669284-133669306 GTCCGGCGCGGGCTGAGGGCTGG + Intronic
1076950276 10:133672583-133672605 GTCCGGCGCGGGCTGAGGGCTGG + Intergenic
1076951261 10:133675882-133675904 GTCCGGCGCGGGCTGAGGGCTGG + Intergenic
1076952251 10:133679192-133679214 GTCCGGCGCGGGCTGAGGGCTGG + Intergenic
1076953239 10:133682502-133682524 GTCCGGCGCGGGCTGAGGGCTGG + Intergenic
1076955207 10:133742153-133742175 GTCCGGCGCGGGCTGAGGGCTGG + Intergenic
1076956197 10:133745463-133745485 GTCCGGCGCGGGCTGAGGGCTGG + Intergenic
1076957185 10:133748772-133748794 GTCCGGCGCGGGCTGAGGGCTGG + Intergenic
1076958174 10:133752082-133752104 GTCCGGCGCGGGCTGAGGGCTGG + Intergenic
1076959158 10:133755381-133755403 GTCCGGCGCGGGCTGAGGGCTGG + Intergenic
1076960147 10:133758691-133758713 GTCCGGCGCGGGCTGAGGGCTGG + Intergenic
1077302703 11:1854623-1854645 GGCCGGGGCTGGCTGAGGGCTGG + Intronic
1077322113 11:1947188-1947210 GGGCGGGGCGGGCGCAGGGCTGG + Intergenic
1077493117 11:2871218-2871240 AGCAGTGGCGGGCAAAGGCCTGG - Intergenic
1077948273 11:6926432-6926454 GGACGGGGCTGGCAAAGGCCTGG + Exonic
1078937122 11:15961768-15961790 GGCCGAGGCGGGCTGAGGTCAGG - Intergenic
1081675338 11:44965291-44965313 GGCTGGGGAGGGCTGAGGCCAGG + Intergenic
1081863445 11:46347257-46347279 GGCCGGGCCGGGCTGGGGGCAGG + Intronic
1081998258 11:47378106-47378128 TGCCCTGGCGGGCTGAGGCCAGG - Intronic
1082912297 11:58390667-58390689 GGGCGGGGCAGGCTCAGGCATGG + Intergenic
1083258141 11:61508937-61508959 GGCCGGGGCGGGGCGATGCCTGG + Exonic
1083292425 11:61697321-61697343 GGCCAGGGCGAGGGAAGGCCTGG + Intronic
1083299932 11:61735007-61735029 GGCCGGGCAGGGCTGGGGCCTGG + Intronic
1084284103 11:68120753-68120775 GGCCGGGGCGGGGTCCGGGCAGG - Intronic
1084946697 11:72642494-72642516 GGCCGGGGCGGGCCGGGGGCGGG - Intronic
1085560973 11:77473259-77473281 GGGCGGGGCGGGGCCAGGCCAGG - Intronic
1086322372 11:85664490-85664512 GGCCCCGGCGAGCTAAGCCCGGG + Exonic
1086337156 11:85811249-85811271 GGCCGGGGCGGGCCGGGGCGGGG - Intergenic
1089993419 11:122882880-122882902 CGCCGGGGCGGGCGGGGGCCCGG + Exonic
1091201231 11:133782562-133782584 GGTCGGGGGAGGCTAAGGCATGG - Intergenic
1091294547 11:134464465-134464487 GGGCTGGGCAGGCTCAGGCCTGG - Intergenic
1202805129 11_KI270721v1_random:2501-2523 GGGCGGGGCGGGCGCAGGGCTGG + Intergenic
1091558627 12:1594287-1594309 GCCCGGGGCGGGGGAGGGCCGGG - Intronic
1091701715 12:2667702-2667724 GGCCTGGGCAGGCTGAAGCCTGG + Intronic
1092002543 12:5044210-5044232 GGCCCGGGCAGGCTGCGGCCAGG + Exonic
1095921956 12:47540644-47540666 GGCCAGGTCGGGGCAAGGCCAGG - Intergenic
1096700634 12:53380529-53380551 GGCCGGGGCGGGCAGGGGGCGGG - Intronic
1096841021 12:54379230-54379252 CTCCGGGGCGGGCTCCGGCCCGG - Intronic
1101150346 12:101877641-101877663 GGCCGGGGCAGGCCCAGCCCCGG - Exonic
1101523272 12:105504473-105504495 GGCCAGGGGGCGCTAAGGACAGG - Intergenic
1102289287 12:111685815-111685837 GGCCCCGGCGGGCTCAGGCGAGG + Exonic
1103048792 12:117761278-117761300 GGCGGGGGCGGGCACAAGCCCGG + Exonic
1103979143 12:124725010-124725032 GGCCGAGGCGGGCGGAGGTCGGG - Intergenic
1112012122 13:95301321-95301343 GGGCGGGGCGGGCGCGGGCCGGG + Exonic
1112050735 13:95642129-95642151 GGCGGCGGCGGCCTAAGGTCTGG + Exonic
1113031465 13:105998019-105998041 GGCCAGGGCAGGGTGAGGCCTGG - Intergenic
1113505307 13:110812433-110812455 GGCCAGCGGGGGCTAAGTCCCGG - Intergenic
1113841404 13:113363688-113363710 GGACGGGCCGGGCAAAGTCCGGG - Intronic
1113872219 13:113566253-113566275 GGCCGGGGCGGGCGACAGCGGGG + Intergenic
1113946794 13:114048876-114048898 GGCTGGGGAGGGCTGAGGGCAGG + Intronic
1114659311 14:24334671-24334693 CCCCGGGGCTGGCTAGGGCCGGG + Exonic
1118809012 14:69260399-69260421 GGCCGGGGCGCGCAGAGGGCAGG + Exonic
1121118908 14:91363789-91363811 CGCGGGGGAGGGCAAAGGCCTGG - Intronic
1122145079 14:99684175-99684197 GGGCGGGGCGGGGGAGGGCCCGG + Intergenic
1122265793 14:100546342-100546364 GGCCGGGGCGGGGCGAGGGCCGG - Intronic
1122265802 14:100546359-100546381 GGCCGGGGCGGGGCGAGGGCCGG - Intronic
1122265811 14:100546376-100546398 GGCCGGGGCGGGGCGAGGGCCGG - Intronic
1122265820 14:100546393-100546415 GGCCGGGGCGGGGCGAGGGCCGG - Intronic
1122265829 14:100546410-100546432 GGCCGGGGCGGGGCGAGGGCCGG - Intronic
1122265838 14:100546427-100546449 GGCCGGGGCGGGGCGAGGGCCGG - Intronic
1122265847 14:100546444-100546466 GGCCGGGGCGGGGCGAGGGCCGG - Intronic
1122265856 14:100546461-100546483 GGCCGGGGCGGGGCGAGGGCCGG - Intronic
1122602400 14:102928293-102928315 AGCCCGGGCGAGCTCAGGCCCGG - Intronic
1123061956 14:105598484-105598506 GGCCGGGCCGGGGTAGGGCCAGG - Intergenic
1123086700 14:105720215-105720237 GGCCGGGCCGGGGTAGGGCCAGG - Intergenic
1202930971 14_KI270725v1_random:31589-31611 GGCCAGGGCAGGCCAAGACCAGG - Intergenic
1202931057 14_KI270725v1_random:31873-31895 GGCCAGGGCAGGGCAAGGCCAGG - Intergenic
1123421466 15:20140118-20140140 GGCCAGGGCAGGGCAAGGCCAGG + Intergenic
1123443667 15:20306702-20306724 GGCCAGGGCAGGGCAAGGCCAGG - Intergenic
1123530692 15:21146658-21146680 GGCCAGGGCAGGGCAAGGCCAGG + Intergenic
1123739784 15:23225800-23225822 GGCCGGTGCGGGGTGAGGTCCGG + Intergenic
1124291010 15:28454773-28454795 GGCCGGTGCGGGGTGAGGTCCGG + Intergenic
1125485605 15:40108813-40108835 GGCGGCGGCGGGCACAGGCCGGG + Exonic
1125535859 15:40441045-40441067 GGCCGGGGCGGGCGGACGGCGGG - Intronic
1125676588 15:41505371-41505393 GGCCTGGGGGGGCTAAGACAAGG + Intronic
1125722713 15:41852866-41852888 GGCTGGAGCAGGCTGAGGCCTGG - Exonic
1128149058 15:65350357-65350379 GGCTGAGGCGGGCTGAGGTCAGG - Intronic
1129386998 15:75201851-75201873 GGGCGGGGCGGGCTGGGGGCGGG - Intronic
1129854036 15:78811537-78811559 GGCCGGGGCGGGGCGGGGCCAGG - Intronic
1129890550 15:79068980-79069002 GGCCTGGCCGGGCTTAGGCTTGG + Intronic
1130925609 15:88383552-88383574 GGCCAGGGTGAGCTGAGGCCAGG + Intergenic
1132477048 16:145019-145041 GGCCGGGGAGGACAAAGGCCGGG - Intergenic
1132815901 16:1826474-1826496 GGCCGCGGCGGACGCAGGCCTGG + Intronic
1132885799 16:2181442-2181464 GGCCGGTGTGGGCTCAGGCGGGG + Exonic
1133010081 16:2905756-2905778 GGGCGGGCCGGGCCAAGGGCGGG + Intergenic
1133062297 16:3182930-3182952 GGCGGAGGCGGGCGAGGGCCCGG - Intergenic
1133103933 16:3494845-3494867 GGCCGGGGCGTCCTTGGGCCTGG + Exonic
1133220106 16:4316156-4316178 GGCCGGGACGGGCGGGGGCCGGG - Intronic
1133933688 16:10252276-10252298 GGCTGGGGAGGACTGAGGCCCGG - Intergenic
1134419340 16:14071385-14071407 GGCCGTTGGGGGCTGAGGCCGGG + Intronic
1136229949 16:28880133-28880155 CGCGGGGAAGGGCTAAGGCCAGG - Intronic
1136669120 16:31839841-31839863 GGCTGGGGCAGGCTGAAGCCTGG - Intergenic
1136707752 16:32202870-32202892 GGCCGGCGCGGGGTGAGGTCCGG - Intergenic
1136722543 16:32337189-32337211 GGCCAGGGCAGGGCAAGGCCAGG + Intergenic
1136760157 16:32726541-32726563 GGCCGGCGCGGGGTGAGGTCCGG + Intergenic
1136807947 16:33143845-33143867 GGCCGGCGCGGGGTGAGGTCCGG - Intergenic
1136840867 16:33543182-33543204 GGCCAGGGCAGGGCAAGGCCAGG + Intergenic
1136862751 16:33712982-33713004 GGCCAAGGCGGGCTCAGGGCAGG - Intergenic
1137261188 16:46831212-46831234 GGACTGGGCGGGCGGAGGCCGGG - Exonic
1137614179 16:49837177-49837199 GGCCCTGGCGAGCTGAGGCCTGG + Intronic
1137617131 16:49855109-49855131 GCCCGGGCCGGGAGAAGGCCTGG + Intronic
1138561324 16:57802409-57802431 GGCCGGGCCGGGCCGAGCCCCGG - Exonic
1139451242 16:67029382-67029404 GGCCGGCGCGGCCTCAGGGCGGG + Exonic
1139469141 16:67169112-67169134 GGTCGGGGAGGGCAGAGGCCAGG + Intronic
1139544778 16:67645070-67645092 GGCCGGGGCGGGGAGGGGCCGGG + Exonic
1141518906 16:84564581-84564603 GGCTGGGGCGGGCTGGGGCTGGG + Intergenic
1141526998 16:84618103-84618125 GGGCGGGGCGGGCCACGGCCTGG - Intergenic
1141958460 16:87388523-87388545 GGCCGAGGAGGCCTGAGGCCTGG + Intronic
1142177220 16:88650822-88650844 GGCCGGGCCGGGGTCAGGCCAGG - Intronic
1142177288 16:88651068-88651090 GGGCGGGGCGGGGTTCGGCCGGG - Exonic
1203003888 16_KI270728v1_random:180575-180597 GGCCAGGGCAGGGCAAGGCCAGG - Intergenic
1203062311 16_KI270728v1_random:986863-986885 GGCCGGCGCGGGGTGAGGTCCGG + Intergenic
1203135496 16_KI270728v1_random:1716982-1717004 GGCCAGGGCAGGGCAAGGCCAGG - Intergenic
1203151032 16_KI270728v1_random:1843479-1843501 GGCCAGGGCAGGGCAAGGCCAGG + Intergenic
1142638233 17:1270739-1270761 GGCCGGTGCGGTCCAAGGCGCGG + Exonic
1142712784 17:1732507-1732529 GGCCAGGGCGGGCTGGGGCGGGG + Intronic
1142966899 17:3587262-3587284 GTCCGGGGCTGGGAAAGGCCTGG - Intronic
1143095175 17:4475093-4475115 GGCCGGGGATGACTAAAGCCAGG + Intronic
1143203578 17:5128491-5128513 GGGCGGGGAGGGCTGAGGTCAGG + Intronic
1144726750 17:17506129-17506151 GGCCAGGGCAGGCTCAGGACAGG - Intronic
1144756441 17:17682697-17682719 GGCCGCGACGGCCTAGGGCCTGG - Intronic
1145191529 17:20844303-20844325 GGCCGGCGCGGGGTGAGGTCCGG - Intronic
1146009195 17:29180236-29180258 CGGCGGGGCGGGCTCCGGCCGGG - Intronic
1146787322 17:35731728-35731750 AGTCGGGGCGGGCTCAGGGCGGG - Exonic
1147204221 17:38825124-38825146 GGCGGGGGAGGACTGAGGCCGGG - Intronic
1147608370 17:41786608-41786630 GGCCGGGTCGGGGTCGGGCCGGG + Exonic
1147710167 17:42458044-42458066 GGCCGAGGCGGGTGGAGGCCAGG + Intergenic
1148048695 17:44759021-44759043 GGCCGGAGCGCGCTGAGCCCCGG + Exonic
1149692407 17:58589036-58589058 GGCCAGGGCAGGCGGAGGCCAGG + Intronic
1150778646 17:68101579-68101601 GGCCGCGGCGGCCTCAGGTCCGG + Intergenic
1150823841 17:68457518-68457540 GGACGGGGCGGGGTAGGGGCGGG - Intergenic
1150823856 17:68457545-68457567 GGACGGGGCGGGGTAGGGGCGGG - Intergenic
1150823871 17:68457572-68457594 GGACGGGGCGGGGTAGGGGCGGG - Intergenic
1151466621 17:74289760-74289782 GGCCTGGGAGGGCTGAGGGCTGG + Intronic
1152088534 17:78234409-78234431 GGCAGGGGCTTCCTAAGGCCAGG - Intronic
1152110570 17:78355569-78355591 GGTCGAGGTGGGCTAAGGGCTGG - Intergenic
1152161156 17:78669480-78669502 GGGATGGGCTGGCTAAGGCCTGG - Intergenic
1152338899 17:79713655-79713677 GGCCGCGCTGGGCTAAAGCCAGG - Intergenic
1152362132 17:79837626-79837648 GGTGGGGGCGGGGCAAGGCCAGG - Intronic
1152628689 17:81399928-81399950 GGCCGGGGCGGGCGCGGGACGGG + Intronic
1152711165 17:81871101-81871123 GGGCGGTGCGGGCTAGGGCGGGG - Intronic
1152853025 17:82648660-82648682 GGGCGGGGCGGGATGAGGCGGGG + Intergenic
1152853039 17:82648694-82648716 GGGCGGGGCGGGATGAGGCGGGG + Intergenic
1152934667 17:83129027-83129049 GCCCGGGGCCGGGTCAGGCCAGG + Intergenic
1154175787 18:12086808-12086830 GGCAGGGACGGGCCAAGGCAGGG - Intergenic
1155910334 18:31498148-31498170 GGCCGGGCCGGGGGGAGGCCGGG + Exonic
1156448757 18:37254535-37254557 TGGCGGGGCGGGCAGAGGCCGGG - Intronic
1158553909 18:58459638-58459660 GGCAGGGGCGGGCTCAAGCATGG - Intergenic
1160452078 18:78973241-78973263 GGCCGGGGAGCTCTACGGCCAGG + Intergenic
1160684126 19:425531-425553 GGCCGGGGAGGGCCAGGGCGGGG - Intronic
1160745407 19:709027-709049 GGCCGGGGCGGGCTAAGGCCTGG - Intergenic
1160994678 19:1877136-1877158 GGCCGGCGCGGGGTGAGGTCCGG + Exonic
1161018018 19:1992978-1993000 GGCGGGGGCGGGGCCAGGCCTGG - Intronic
1161026725 19:2040386-2040408 GGCTGGGCCAGGCTGAGGCCTGG + Intronic
1161505220 19:4640046-4640068 GGCCCGGGCTGGCCTAGGCCTGG - Exonic
1161607326 19:5222362-5222384 GGCAGGGCCGGGCCAGGGCCAGG - Intronic
1161967165 19:7555145-7555167 GGCCTGGGAGGGCTGAGGACAGG + Intronic
1161979437 19:7622895-7622917 TGCCGGGGCGGGCAGAGGCGAGG + Intronic
1162577067 19:11505413-11505435 GGAGGGGGCGGGGTAAAGCCCGG + Intronic
1162740217 19:12769854-12769876 GGCGGGGGCGGGGTTAGGGCCGG - Intronic
1162935282 19:13978815-13978837 GGTCGGGGCTGGCTCGGGCCGGG + Intronic
1163269300 19:16241083-16241105 GGCCGAGGCGGGCAGAGGTCAGG + Intronic
1163575721 19:18109915-18109937 GGCCGGGGCGGGGAGAGGCGGGG + Intronic
1163577175 19:18117823-18117845 GGCCGCGGGCGGCTGAGGCCGGG - Intronic
1163829371 19:19540516-19540538 GGGCGGGGCTGGCGAACGCCGGG + Intronic
1164412678 19:28018973-28018995 TGCCTGGGCTGGCTAAGGTCCGG - Intergenic
1165062676 19:33212487-33212509 GGCCGAGTCGGGGTAAGGGCCGG - Intronic
1165138262 19:33684352-33684374 GGCCTGGGTGTGCCAAGGCCCGG + Intronic
1165363862 19:35352169-35352191 GGCCGGAGCGGGCCAGTGCCCGG - Exonic
1165431555 19:35776027-35776049 CGCCGGGGAGGGCTGAGGGCTGG - Intronic
1165433393 19:35784608-35784630 GGCCGGGGCGGGGTCAAGTCTGG - Intronic
1166215320 19:41330997-41331019 GGGCGGGGCGGGGTGGGGCCGGG + Exonic
1166869774 19:45864263-45864285 GCCCGGGGCGGGCGAGGGCGGGG + Exonic
1167464300 19:49642185-49642207 GGGCGGGGCGGGCTGGGGCGGGG - Exonic
1168064162 19:53909763-53909785 GGCTGGGGAGGGCAGAGGCCGGG + Intronic
1168622190 19:57888565-57888587 GACTGGCGCGGGCAAAGGCCTGG - Intronic
1168628124 19:57934956-57934978 GACCGGCGCGGGCTATGGCCTGG - Intronic
1202691117 1_KI270712v1_random:96273-96295 GGCCAGGGCAGGGCAAGGCCAGG + Intergenic
925235277 2:2272347-2272369 GGCGGGGGCAGGGTGAGGCCAGG - Intronic
925845813 2:8032184-8032206 GGCCGAGGCGGGCTAATCACTGG + Intergenic
927246707 2:20962374-20962396 GGCAGGGGCTGGCTAAGGACAGG + Intergenic
927917254 2:26945189-26945211 GGCTGGGGTGGGCGAAGGGCTGG - Intronic
928220948 2:29402232-29402254 GCCAGGGGCTGGCTAAGGGCTGG + Intronic
931291856 2:60881098-60881120 GGCCTGGGAGGGCGACGGCCGGG - Intergenic
932238857 2:70142131-70142153 GACCGGGGCGGGTGTAGGCCCGG + Intergenic
932442606 2:71747230-71747252 GCCCAGGGCAGGCAAAGGCCAGG + Intergenic
933666669 2:84970715-84970737 GCCTGGGGCGGGCCTAGGCCGGG - Intergenic
933955276 2:87357678-87357700 GGCCAGGGCAGGGCAAGGCCAGG - Intergenic
933955371 2:87357991-87358013 GGCCAGGGCAGGGCAAGGCCAGG - Intergenic
934239464 2:90253891-90253913 GGCCAGGGCAGGGCAAGGCCAGG - Intergenic
934273636 2:91562539-91562561 GGCCAGGGCAGGGCAAGGCCAGG + Intergenic
934273721 2:91562807-91562829 GGCCAGGGCAGGGCAAGGCCAGG + Intergenic
934322843 2:91983461-91983483 GGCCGGGGCAGGGCAAGGGCCGG - Intergenic
934900306 2:98154613-98154635 GGCAGGGGTGGGCTCAGCCCAGG + Intronic
936512151 2:113157314-113157336 GGGAGGGGCGGGCTGAGGCCGGG - Intronic
938066303 2:128283695-128283717 GGCAGGGGTGGGCTTTGGCCAGG + Intronic
938074078 2:128322718-128322740 GGGGGGGGCGGGCAAGGGCCGGG - Intergenic
939990720 2:148875362-148875384 GGCAGGGGCGGGGCAGGGCCAGG + Exonic
940409705 2:153347185-153347207 AGCTTGGGCAGGCTAAGGCCAGG - Intergenic
942043825 2:172087708-172087730 GCCCCTGGCAGGCTAAGGCCTGG + Intronic
942448336 2:176092866-176092888 GGCCGGGGCCGGGCCAGGCCGGG + Intergenic
944635605 2:201673419-201673441 GGCCGGTGGGGGCTAAGGGGAGG + Intronic
946427749 2:219608445-219608467 GGCTGGGGCGAGCTGAGGCCAGG + Intronic
946431004 2:219627481-219627503 GGCCGGGGCGGGGTGAGTCACGG + Intronic
947623353 2:231604675-231604697 GGCCGGGCCGGGCTGGGGCTGGG - Intergenic
947752817 2:232541581-232541603 GGCAGTGGTGGGGTAAGGCCTGG + Intronic
948206907 2:236167383-236167405 GGCGGGGGCGGGCCAGCGCCGGG - Intronic
948385671 2:237579113-237579135 GGACGGGGCGGGGGAAGGCAAGG + Intronic
948786167 2:240354089-240354111 GGCCAGGGCAGACTCAGGCCGGG - Intergenic
948831280 2:240599352-240599374 GGCCGGGGCAGGTCAAGCCCTGG + Intronic
1169061567 20:2664109-2664131 GGCAGGGGCGGGCGAAGGAGCGG - Intronic
1169141693 20:3230383-3230405 GGCTGGGGTGGGCTCAGGCAAGG - Intronic
1169268564 20:4182280-4182302 CTCTGGGGCGGGCTGAGGCCTGG - Exonic
1172596479 20:36154368-36154390 GCCCGGGGCTGGCTAGGACCAGG + Intronic
1172644572 20:36461674-36461696 GGCGGGGGCGGGGCAGGGCCGGG - Intronic
1172911626 20:38413739-38413761 GGCCGAGGCAGGCTGAGGTCAGG + Intergenic
1173944601 20:46940791-46940813 GGCCTGGGGGTGCTCAGGCCTGG - Intronic
1175349564 20:58309038-58309060 GGGCGGGGCGGGCTGAGGGTGGG - Intergenic
1176098875 20:63356135-63356157 GGCAGGGGCGGGACAGGGCCAGG + Intronic
1176098907 20:63356211-63356233 GGCAGGGGCGGGACAGGGCCAGG + Intronic
1176111415 20:63412517-63412539 AGCAGGAGTGGGCTAAGGCCTGG + Intronic
1176169967 20:63692320-63692342 GGCCTGGGCTGGCGAGGGCCTGG + Intronic
1176178994 20:63740888-63740910 GGCAGGGGCGGGCCCTGGCCTGG + Intronic
1176234752 20:64049102-64049124 GGGCGGGGGGGGCTCGGGCCGGG - Intronic
1176380722 21:6111069-6111091 GGCCGGGGCGGGCCGGGGCGGGG + Intergenic
1176592996 21:8660227-8660249 GGCCAGGGCAGGGCAAGGCCAGG - Intergenic
1176593080 21:8660495-8660517 GGCCAGGGCAGGGCAAGGCCAGG - Intergenic
1178831315 21:36059458-36059480 GCCCGAGGCGGGCTGAGGTCAGG + Exonic
1178948398 21:36966689-36966711 GGCCGGGGCGGGGCCGGGCCTGG - Intronic
1179742750 21:43427171-43427193 GGCCGGGGCGGGCCGGGGCGGGG - Intergenic
1180275837 22:10637338-10637360 GGCCAGGGCAGGGCAAGGCCAGG - Intergenic
1180275843 22:10637354-10637376 GGCCAGGGCAGGGCAAGGCCAGG - Intergenic
1180275927 22:10637622-10637644 GGCCAGGGCAGGGCAAGGCCAGG - Intergenic
1180550318 22:16532267-16532289 GGCCAGGGCAGGGCAAGGCCAGG - Intergenic
1180550330 22:16532299-16532321 GGCCAGGGCAGGGCAAGGCCAGG - Intergenic
1180550424 22:16532600-16532622 GGCCAGGGCAGGGCAAGGCCAGG - Intergenic
1180699686 22:17774502-17774524 GGCCGGGGCGGGCCCGGGCGTGG - Intronic
1181057653 22:20267727-20267749 GGCCGGGGCGCTCCGAGGCCGGG + Intronic
1181120765 22:20667753-20667775 GGCCGGCGCGGGGTGAGGTCCGG + Intergenic
1181333730 22:22114780-22114802 GGCCGGCGCGGGGTGAGGTCCGG + Intergenic
1181354245 22:22289211-22289233 GGCCAGGGCAGGGCAAGGCCAGG + Intergenic
1182401370 22:30080261-30080283 GGGCCGGGCGGGCTAGGGGCCGG + Exonic
1183096094 22:35553187-35553209 AGCAGGGGCGGGCAGAGGCCAGG - Exonic
1183409814 22:37648291-37648313 GGCGGAGGCAGGCTTAGGCCAGG - Intronic
1183622479 22:38982542-38982564 GGCAGGGGCGGGGGGAGGCCAGG - Intronic
1183638180 22:39077452-39077474 GGCTGGGGCAGGGGAAGGCCAGG - Intronic
1184034049 22:41910242-41910264 GGCCGGGGCGGGCCGGGGGCGGG + Intronic
1184260101 22:43310104-43310126 GGCCGGGGCTGGGTCAGGCAGGG - Intronic
1184545473 22:45164373-45164395 GGCGGGAGCGGGCTCGGGCCTGG + Intronic
1184557457 22:45240964-45240986 GGCCGGGGCGGGGAAGGGGCGGG - Intergenic
1185165290 22:49258219-49258241 GCCCCGGGCTGGCTCAGGCCGGG + Intergenic
1185287957 22:50010817-50010839 GGCGGGGGGGGGCTGAGCCCGGG + Intronic
1185400433 22:50612874-50612896 GGCAGGGGCGGGGCCAGGCCGGG - Intronic
1185409463 22:50674492-50674514 GGCCGGGGGGGGCCGGGGCCGGG - Intergenic
949304322 3:2622507-2622529 GGCCGAGGTGGGCTGAGGTCAGG - Intronic
950097416 3:10338119-10338141 GGCCGGGGCGGGCCAGGGGATGG - Intronic
950496033 3:13335198-13335220 GGGAGGGGCTGGCAAAGGCCTGG - Intronic
952347609 3:32502886-32502908 GGGCGGGGCGGGCCAAGGGCGGG - Exonic
952816679 3:37452736-37452758 GTCCGGGGCCCGCTAAGGTCGGG + Intronic
953064476 3:39456367-39456389 GGACGGGGAGGGCTGCGGCCGGG - Intergenic
953924729 3:46976884-46976906 GGGCGGGGCGGGGCAAGGCGGGG - Intronic
954266023 3:49470683-49470705 GCGCGGGCCGAGCTAAGGCCTGG - Intronic
954887760 3:53891646-53891668 GGCCGCGGGGCGCTAAGCCCGGG + Intronic
956816755 3:72914948-72914970 GGCCAAGGCAGGCTAAGGCCAGG + Intronic
961359417 3:126357551-126357573 GGCCGGGGCGGGGCCAGGGCGGG - Intergenic
961446334 3:126983334-126983356 GGCCGGGCCGGGCTGGGGTCCGG + Intergenic
961754794 3:129121465-129121487 GGCAGGGCCGGGCCCAGGCCCGG - Exonic
962164830 3:133038297-133038319 GGCCGGGGCGGGCCAGAGCCTGG + Intergenic
963601255 3:147380831-147380853 GGCCGGGGCGCGCCTGGGCCAGG - Intergenic
965648346 3:170908348-170908370 GGCCGGGCCGAGCTGAGCCCTGG - Intronic
965682285 3:171263857-171263879 GGGCAGGGCGGGCAGAGGCCTGG + Intronic
966883704 3:184363054-184363076 GGCGGGGTAGGGCTAGGGCCCGG + Intronic
969723138 4:8904351-8904373 GGCCGCGGCTGGCTATGACCTGG - Intergenic
970397217 4:15681321-15681343 GGCTGGGGCGGGCGCGGGCCGGG + Intronic
977606899 4:98993581-98993603 GGCCGGGGGAGGCTCAGGCATGG + Intergenic
982042389 4:151409099-151409121 GGCCGGGGCGGGGCAGGGGCGGG - Intergenic
982177552 4:152720220-152720242 GGCCGAGGTGGGCAGAGGCCAGG + Intronic
985451757 4:190066778-190066800 GTCCGGCGCGGGCTGAGGGCTGG + Intergenic
985452745 4:190070070-190070092 GTCCGGCGCGGGCTGAGGGCTGG + Intergenic
985453731 4:190073363-190073385 GTCCGGCGCGGGCTGAGGGCTGG + Intergenic
985454720 4:190076656-190076678 GTCCGGCGCGGGCTGAGGGCTGG + Intergenic
985455710 4:190079953-190079975 GTCCGGCGCGGGCTGAGGGCTGG + Intergenic
985456693 4:190083247-190083269 GTCCGGCGCGGGCTGAGGGCTGG + Intergenic
985457680 4:190086543-190086565 GTCCGGCGCGGGCTGAGGGCTGG + Intergenic
985458668 4:190089840-190089862 GTCCGGCGCGGGCTGAGGGCTGG + Intergenic
985459657 4:190093140-190093162 GTCCGGCGCGGGCTGAGGGCTGG + Intergenic
985673578 5:1218902-1218924 GGCCGTGGAGGGCACAGGCCTGG + Exonic
985746461 5:1651548-1651570 GGCTGGGGAGGGATGAGGCCTGG + Intergenic
985786534 5:1898273-1898295 GGACGGGGAGGTCTAAGGCCAGG - Intergenic
986273511 5:6254011-6254033 AGCCAGGGCAGGCCAAGGCCAGG - Intergenic
989965856 5:50465279-50465301 GGCCGGGGAAGGCTCAGGCATGG - Intergenic
992682586 5:79167637-79167659 GGCCGGGCCTGGTTAAGCCCAGG - Intronic
992940586 5:81757385-81757407 GGCCGGGGCGGGCCAAGGTCTGG + Intergenic
996810995 5:127516487-127516509 GGCCGAGGCGGGCCGAGGTCAGG + Intergenic
998263322 5:140647681-140647703 GGCAGGGGCGGGGTAAAGCTTGG + Exonic
999308307 5:150535046-150535068 GAGCGGGGCGGGCTAAGGGCTGG + Intronic
1002334481 5:178468533-178468555 GGACGGGGCCGGGTGAGGCCTGG - Intronic
1002541290 5:179907920-179907942 GGCCGGGGCGGGGCGGGGCCGGG + Intergenic
1003164688 6:3665902-3665924 GGCTGGGGTTGGCCAAGGCCAGG - Intergenic
1003282559 6:4706555-4706577 GGCCAAGGCGGGCTGAGGTCAGG + Intronic
1004424205 6:15496718-15496740 GGCCGAAGCGGGCCACGGCCGGG + Exonic
1005303793 6:24495100-24495122 GGCCGGGCCGGGCGCAGGCCCGG - Exonic
1007784083 6:44270521-44270543 GGCCGGGGGGGGCCGGGGCCGGG - Exonic
1013372599 6:109483368-109483390 GGGCGGGGCGGGGCAAGGCGGGG + Intergenic
1013372696 6:109483610-109483632 GGCCGGGGCGGGGCGCGGCCAGG + Intergenic
1017705534 6:157119392-157119414 AGCCGGGGCTGGATAAGGACAGG - Intronic
1018635442 6:165855448-165855470 GGCAGGGGCGATCTCAGGCCGGG - Intronic
1019405834 7:883672-883694 AGCCGGGCCGGGAGAAGGCCCGG + Intronic
1019473386 7:1232943-1232965 GGCCGGGGCGGGCCAGCGGCGGG - Exonic
1019476330 7:1246445-1246467 GGGCAGGGCGGGCAGAGGCCGGG + Intergenic
1020009579 7:4800713-4800735 GGCTGGGCTGGGCTAGGGCCTGG - Intronic
1020037623 7:4974307-4974329 GGCCCGGGCGGGATCGGGCCGGG + Intergenic
1020262276 7:6537007-6537029 GGAGGGGGCGGGCTGAGTCCGGG + Intronic
1023773576 7:43582961-43582983 GGCCGGGGCGGGGTCGGGCGCGG + Intronic
1025261727 7:57424820-57424842 GGCCGGGCCGGGCTGGGGCGTGG - Intergenic
1026570071 7:71521645-71521667 GGCCTGGGCGTGAGAAGGCCAGG - Intronic
1026817087 7:73521768-73521790 GGCTGGGCCGGGGTAGGGCCTGG - Intronic
1026828196 7:73596722-73596744 GGCCGGGGCGGTGTAGGGGCCGG + Exonic
1027151939 7:75739218-75739240 GGCCGGGGCGGGGTGCGGACGGG + Intergenic
1028160099 7:87475693-87475715 GGCCGCGGCGAGCAAAGTCCAGG - Exonic
1029501923 7:100936613-100936635 GGCCGAGGCGGGCGGAGGTCAGG - Intergenic
1033472134 7:141659728-141659750 GGCAGGCGAGGGCTGAGGCCCGG + Exonic
1033654105 7:143361976-143361998 GGCGGGGGCGGGATGAGCCCGGG - Intronic
1034437770 7:151071302-151071324 GGCCAGGGCGGGCTGGGGCCAGG + Intronic
1034532920 7:151707867-151707889 GGCCGGTGCTGGCTCATGCCTGG - Intronic
1035167337 7:156999780-156999802 GGGCGGGCCGGGGTCAGGCCGGG - Intronic
1035167340 7:156999785-156999807 GGCCGGGGCGGGCCGGGGTCAGG - Intronic
1035242830 7:157543380-157543402 GGCCGAGCCAGGCTCAGGCCAGG + Intronic
1035266072 7:157690900-157690922 GGCGCGGGCGGGCTCAGGGCGGG + Intronic
1036563178 8:9914605-9914627 AGCAGGGCCGGGCTAAGGCTGGG - Intergenic
1036650110 8:10636768-10636790 GGCAGGGGAGGGGTCAGGCCCGG - Intronic
1037482027 8:19313980-19314002 GCCCGGGGCGGGCTCAGGTGCGG + Intronic
1037807573 8:22067009-22067031 GGCGGGGGCGGCCCTAGGCCTGG - Intronic
1037813312 8:22099060-22099082 AGCAGGGGCGGGCGGAGGCCGGG + Intronic
1042611601 8:70607605-70607627 GGCCGGGGAAGGCCGAGGCCCGG - Intronic
1047258316 8:123233621-123233643 GGCCGAGGTGGGCGAAGGTCAGG - Intronic
1048375339 8:133818152-133818174 GGCCAGGGCGAGCTGAGACCAGG - Intergenic
1048381816 8:133871912-133871934 GGCCAGGGCAGGCCAAGGCAGGG + Intergenic
1049087606 8:140490610-140490632 GGCCGGGGAAGGCTCAGGCATGG + Intergenic
1049380684 8:142314283-142314305 GGGCGGGGAGGGCCAAGGGCAGG - Intronic
1049457456 8:142700831-142700853 GGCCGGAGCGGGGCAAGGGCTGG - Intronic
1049474542 8:142790617-142790639 GGCCGGGCCGGGCCAGGGGCCGG + Intergenic
1049614038 8:143568640-143568662 GGCCGGGGCGGGCTCCGGCTGGG - Exonic
1051419695 9:16877186-16877208 GGGCGGGGTGGGCTCAGGCATGG + Intergenic
1052756801 9:32550632-32550654 GGCCTCGGCGGGCCAGGGCCAGG - Intronic
1053692391 9:40592929-40592951 GGCCAGGGCAGGGCAAGGCCAGG - Intergenic
1053692473 9:40593225-40593247 GGCCAGGGCAGGGCAAGGCCAGG - Intergenic
1053919490 9:42973740-42973762 GGCCGAGGCGGGCTGAGGTCAGG + Intergenic
1054272344 9:63044308-63044330 GGCCAGGGCAGGGCAAGGCCAGG + Intergenic
1054303633 9:63393847-63393869 GGCCAGGGCAGGGCAAGGCCAGG - Intergenic
1054303715 9:63394143-63394165 GGCCAGGGCAGGGCAAGGCCAGG - Intergenic
1054402493 9:64720653-64720675 GGCCAGGGCAGGGCAAGGCCAGG - Intergenic
1054436021 9:65204688-65204710 GGCCAGGGCAGGGCAAGGCCAGG - Intergenic
1054436103 9:65204984-65205006 GGCCAGGGCAGGGCAAGGCCAGG - Intergenic
1054494289 9:65816703-65816725 GGCCAGGGCAGGGCAAGGCCAGG + Intergenic
1054494371 9:65816999-65817021 GGCCAGGGCAGGGCAAGGCCAGG + Intergenic
1054790663 9:69253678-69253700 GGCCGAGGCGGGCGGAGGTCAGG - Intronic
1055318930 9:75063073-75063095 GGCCGAGGCGGGCGGAGGTCAGG + Intronic
1057199871 9:93134244-93134266 GGCTCGGGCGCGCTCAGGCCCGG - Exonic
1057231799 9:93325718-93325740 GGCAGGGGCAGGCTGGGGCCAGG - Intronic
1057436822 9:95048433-95048455 GGGCGGGGCGGGGTGAGGCGGGG + Intronic
1058908106 9:109497953-109497975 GGCCGGGGCGGGCTGGCGGCCGG - Intronic
1059470935 9:114504717-114504739 GGCCGGGGCGGGCGGCGGCGGGG - Exonic
1060980023 9:127786369-127786391 GGCCGGGGCGGGGTGCGGCGCGG - Intronic
1061226337 9:129283086-129283108 GGCAGGGGCGGGCTAGGCCCTGG + Intergenic
1061248425 9:129413388-129413410 GGCCGCGGCGGGCGGGGGCCGGG - Intergenic
1061969417 9:134035816-134035838 GGCTGGGTGGGGCTCAGGCCTGG + Intronic
1062238330 9:135523178-135523200 GGCCGGGGGAGGCACAGGCCAGG + Intronic
1062448103 9:136604195-136604217 GGCCGGGGTGGGCAACGTCCTGG + Intergenic
1062631550 9:137465318-137465340 GGCCGGGGCAAGGTGAGGCCGGG - Intronic
1203623038 Un_KI270749v1:139018-139040 GGCCAGGGCAGGCCAAGACCAGG - Intergenic
1203623123 Un_KI270749v1:139302-139324 GGCCAGGGCAGGGCAAGGCCAGG - Intergenic
1185761257 X:2691261-2691283 GGCCGGGTGGGGCGAAGCCCGGG - Exonic
1185778768 X:2828723-2828745 GGCCGCGGCGGGCGAGGGGCGGG + Intergenic
1185835744 X:3345393-3345415 GGCAGGGGCGGGGAAAGCCCGGG - Intronic
1187620408 X:21047061-21047083 GGCGGGGGTGGGATAAGCCCTGG + Intergenic
1189179199 X:38987413-38987435 GGCCAGGGCGAGCACAGGCCTGG + Intergenic
1189473993 X:41334882-41334904 GTCTCGGGCGGGCGAAGGCCTGG + Intronic
1190829191 X:54044833-54044855 GGCGGGGGCGGGCTTCAGCCGGG + Intronic
1196768547 X:119271528-119271550 GGCTGAGGCAGGCTAATGCCTGG - Intergenic
1196951730 X:120931484-120931506 AGCCCGGGCGGGCGAGGGCCTGG - Exonic
1196952414 X:120936345-120936367 AGCCCGGGCGGGCGAGGGCCTGG - Exonic
1196953099 X:120941206-120941228 AGCCCGGGCGGGCGAGGGCCTGG - Exonic
1196953784 X:120946066-120946088 AGCCCGGGCGGGCGAGGGCCTGG - Exonic
1196954469 X:120950927-120950949 AGCCCGGGCGGGCGAGGGCCTGG - Exonic
1196955152 X:120955787-120955809 AGCCCGGGCGGGCGAGGGCCTGG - Exonic
1196955839 X:120960670-120960692 AGCCCGGGCGGGCGAGGGCCTGG - Exonic
1196956521 X:120965531-120965553 AGCCCGGGCGGGCGAGGGCCTGG - Exonic
1196957203 X:120970391-120970413 AGCCCGGGCGGGCGAGGGCCTGG - Exonic
1196957885 X:120975251-120975273 AGCCCGGGCGGGCGAGGGCCTGG - Exonic
1196958567 X:120980111-120980133 AGCCCGGGCGGGCGAGGGCCTGG - Exonic
1196959248 X:120984971-120984993 AGCCCGGGCGGGCGAGGGCCTGG - Exonic
1200002105 X:153067439-153067461 GCCCGGGGAGGGCTCAGGCAGGG - Intergenic
1200005628 X:153082586-153082608 GCCCGGGGAGGGCTCAGGCAGGG + Intergenic
1200163284 X:154019853-154019875 GGCCGCGGCGGGCGCGGGCCTGG + Exonic
1200185223 X:154178267-154178289 GGCCGAGGCGGGCGGAGGTCAGG + Intergenic
1200190876 X:154215405-154215427 GGCCGAGGCGGGCGGAGGTCAGG + Intergenic
1200196627 X:154253207-154253229 GGCCGAGGCGGGCGGAGGTCAGG + Intergenic
1200202282 X:154290325-154290347 GGCCGAGGCGGGCGGAGGTCAGG + Intronic
1200988275 Y:9326023-9326045 GGCCGGGGCGTACTGGGGCCAGG - Intergenic
1202109535 Y:21405938-21405960 GGCCGGGGCGTCCTGGGGCCAGG - Intergenic
1202119746 Y:21510170-21510192 GGCCGGGGCGTACTGGGGCCAGG + Intergenic
1202122199 Y:21533711-21533733 GGCCGGGGCGTACTGGGGCCAGG + Intronic
1202156808 Y:21895672-21895694 GGCCGGGGCGTACTGGGGCCAGG - Intronic
1202159254 Y:21919213-21919235 GGCCGGGGCGTACTGGGGCCAGG - Intergenic
1202185703 Y:22184128-22184150 GGCCGGGGCGTACTGGGGCCAGG - Intergenic
1202205657 Y:22402268-22402290 GGCCGGGGCGTACTGGGGCCAGG + Intronic