ID: 1160746021

View in Genome Browser
Species Human (GRCh38)
Location 19:710867-710889
Sequence TCCCCACCCATTGTCAGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 196}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160746021_1160746024 -10 Left 1160746021 19:710867-710889 CCCGGGCTGACAATGGGTGGGGA 0: 1
1: 0
2: 2
3: 30
4: 196
Right 1160746024 19:710880-710902 TGGGTGGGGACAGGCCCATCTGG 0: 1
1: 0
2: 3
3: 20
4: 258
1160746021_1160746025 0 Left 1160746021 19:710867-710889 CCCGGGCTGACAATGGGTGGGGA 0: 1
1: 0
2: 2
3: 30
4: 196
Right 1160746025 19:710890-710912 CAGGCCCATCTGGTGCCGCCCGG 0: 1
1: 0
2: 1
3: 12
4: 168
1160746021_1160746028 6 Left 1160746021 19:710867-710889 CCCGGGCTGACAATGGGTGGGGA 0: 1
1: 0
2: 2
3: 30
4: 196
Right 1160746028 19:710896-710918 CATCTGGTGCCGCCCGGCCTTGG 0: 1
1: 0
2: 0
3: 10
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160746021 Original CRISPR TCCCCACCCATTGTCAGCCC GGG (reversed) Intronic
900380103 1:2379645-2379667 AGCCCACCCACTGTCAGCCGTGG - Intronic
901203846 1:7482943-7482965 GCCCCACCCCATGTCATCCCAGG + Intronic
901447261 1:9316147-9316169 TCCCCACCCCCTGCCAGCCCAGG - Intronic
901690742 1:10971606-10971628 CCCCCACCCATTCTCTACCCTGG + Intronic
902703473 1:18189008-18189030 TCCTCACCCAGGGTGAGCCCAGG - Intronic
902754498 1:18540205-18540227 TGCCCACCCCTTGGCAGCCCAGG - Intergenic
903855905 1:26337448-26337470 TCCCCACCCCTACGCAGCCCAGG + Intronic
904440684 1:30527562-30527584 TGCCTGCCCATTGTGAGCCCAGG + Intergenic
904818240 1:33221270-33221292 TCCCCACCCACAGTCAGGACAGG - Intergenic
908627522 1:66061744-66061766 TCTCCACCCACTGACAGGCCTGG - Intronic
912801520 1:112722694-112722716 TCCCCACGCATTGTAAGCCCTGG + Intronic
915099058 1:153485460-153485482 TCCCCACCTCTTTCCAGCCCAGG + Intergenic
915908156 1:159894783-159894805 TCCCTAGTCATTGTCAGTCCAGG - Intronic
916016703 1:160756165-160756187 TCCCCACCCATTCTCACTCGAGG - Intergenic
917449178 1:175132718-175132740 TCCCCACCCATCCCCTGCCCAGG + Intronic
917646661 1:177035368-177035390 TCCAGACCCATTGTCAGTTCTGG + Intronic
923048082 1:230369974-230369996 ACCCCAGCCACTGTCCGCCCAGG + Intronic
1063044236 10:2375908-2375930 ACCCCCCACATCGTCAGCCCTGG - Intergenic
1063522662 10:6754982-6755004 TCCTCCCCCACTGTCAGCACTGG - Intergenic
1063600872 10:7480245-7480267 TCCCCACCCTTTCCCATCCCGGG - Intergenic
1066455491 10:35568402-35568424 GCCACACCCAGTGGCAGCCCTGG + Intronic
1069721445 10:70552102-70552124 TCCCTACTCAGTGTCCGCCCAGG - Intronic
1069849890 10:71397712-71397734 TCCCCTCCCCTTCTGAGCCCTGG + Intronic
1070733997 10:78851199-78851221 ACCCCACCCATTGTGTGTCCAGG - Intergenic
1071907141 10:90186902-90186924 TGCCCACCCAGTGCTAGCCCTGG + Intergenic
1072189922 10:93070696-93070718 TCATCACCCATTGTCAGCCAAGG + Intergenic
1073100754 10:101005390-101005412 TCCCCACTCAGTGTCTGCTCTGG - Intronic
1073497443 10:103906217-103906239 ACCCCACCCACTGTAAGTCCAGG - Intronic
1073604732 10:104882755-104882777 TCCCCACCCAGTGCCACTCCTGG + Intronic
1074371947 10:112907340-112907362 TCCCCAGCCAAAGTCAGCCCTGG + Intergenic
1074974482 10:118569055-118569077 TCCTCACCCATGGGCAGCTCAGG - Intergenic
1075644717 10:124090070-124090092 GCCACACCCATTGTGGGCCCAGG - Intronic
1075954117 10:126507658-126507680 TCACCAGCAGTTGTCAGCCCAGG + Intronic
1077108851 11:853376-853398 TCCACACCCATGGTCAGGCTAGG + Intronic
1079417355 11:20251863-20251885 ACCACAGGCATTGTCAGCCCAGG - Intergenic
1082829435 11:57604525-57604547 TCCCCACCCAGCCTCAGCCAGGG + Intronic
1083651714 11:64208134-64208156 CCCCCACCCACTGGCAGCCCAGG - Intronic
1083827437 11:65211515-65211537 GCCCCACCCATTGCCAAGCCAGG + Exonic
1084714395 11:70864438-70864460 GCTCCAGCCAATGTCAGCCCAGG + Intronic
1086499555 11:87437904-87437926 TCCCCTTCCACTGCCAGCCCAGG - Intergenic
1088469539 11:110178003-110178025 TCCCCACACAGTGACATCCCAGG + Intronic
1090213367 11:124938756-124938778 TCCCCACTCAAAGTGAGCCCCGG - Intergenic
1092918925 12:13213596-13213618 ACCACACCTATTGTCAGCACTGG - Intronic
1094063184 12:26336222-26336244 TCCCCACTCATTCTCAGTCCTGG + Intergenic
1097980149 12:65729549-65729571 TCCCCACCCAGTCTCAGTTCAGG - Intergenic
1098977557 12:76919025-76919047 TCCCCAAGAATTATCAGCCCTGG - Intergenic
1101532397 12:105585563-105585585 TCTCCACCCATTTCCAGGCCGGG - Intergenic
1102710027 12:114917768-114917790 TCCCAACTTAATGTCAGCCCTGG - Intergenic
1103605392 12:122082127-122082149 TCCACACCCAAAGTCAGCCCCGG - Intronic
1104522254 12:129486597-129486619 TCCCCACTCATTGTGTGTCCAGG + Intronic
1106003546 13:25747628-25747650 TCCCCACGCATTGTATCCCCAGG - Intronic
1111270148 13:85871186-85871208 TCCCTACGTATTGGCAGCCCAGG + Intergenic
1116055456 14:39858846-39858868 TCCTGCCCCATTGTCAGCCCCGG + Intergenic
1117773832 14:59162043-59162065 TCCCACCCCATGCTCAGCCCAGG - Intergenic
1118760596 14:68878426-68878448 ACCCCACCCTCTGTCTGCCCTGG - Intronic
1120712973 14:87812100-87812122 TCCTGACCCCTTGTCAGCCTAGG - Intergenic
1122929674 14:104927541-104927563 TCCCACCCCAGTGGCAGCCCAGG + Intronic
1123019213 14:105389777-105389799 TCTCCAACCACTGCCAGCCCTGG - Intronic
1124590294 15:31047617-31047639 ACCCCACCCAGTGGCCGCCCTGG + Intronic
1128078286 15:64841776-64841798 TCCCCACCCATTTCCCGCCCTGG + Intergenic
1128282929 15:66411833-66411855 TTCCCACCCATTCTCTGTCCAGG + Intronic
1128632165 15:69278634-69278656 TCTCCACCCCTTCTCAGCCCTGG - Intergenic
1129324089 15:74790422-74790444 TCCCCACTCCTTGTCAGCCTGGG + Intronic
1129740752 15:77988539-77988561 AGCCCTTCCATTGTCAGCCCGGG + Intronic
1129844973 15:78764001-78764023 GGCCCTTCCATTGTCAGCCCGGG - Exonic
1130726898 15:86448499-86448521 TCCCCACCCATTGTCAGTTAAGG + Intronic
1133140634 16:3741161-3741183 TCCTCACCCAGGGCCAGCCCCGG + Intronic
1133678585 16:8099040-8099062 GCCCAACCCAGAGTCAGCCCAGG - Intergenic
1134002670 16:10794855-10794877 TCCCCACTCACTCTCAGCCCAGG + Intronic
1134845026 16:17433010-17433032 TCCCAACCCAATCCCAGCCCAGG + Intronic
1135620373 16:23950374-23950396 TCCCAACCCATTGTCAGGCAGGG + Intronic
1136135599 16:28255271-28255293 TCACCACTCAGGGTCAGCCCTGG - Intergenic
1137272936 16:46914721-46914743 TCCCCGCTCATCGTCTGCCCTGG - Intronic
1138304684 16:55963626-55963648 TCCCCTGCCAGTGTCAGCCTTGG + Intergenic
1138425844 16:56931721-56931743 CCCCCACCCTTTTTCACCCCAGG - Intergenic
1140770992 16:78203905-78203927 TCCACACTCACTGTTAGCCCAGG - Intronic
1144665592 17:17100029-17100051 TCCCCACCCAGCGCCATCCCAGG - Intronic
1144773248 17:17771055-17771077 TCCCCATCCATTATCATCCCAGG - Intronic
1146475729 17:33161153-33161175 CCCCCACCCTTTCTCAGCACAGG - Intronic
1146655850 17:34634787-34634809 TCCCCACCCCAGGTCAGTCCGGG + Exonic
1146941302 17:36846069-36846091 TCCCCACCCCTTTTCCTCCCTGG - Intergenic
1148162027 17:45455719-45455741 ACCCCACCCACTGTCATCTCTGG + Intronic
1148185835 17:45643093-45643115 TGCCCAACCATTGCCAACCCAGG - Intergenic
1148354091 17:46963736-46963758 TCCCCACCCACAGTCACCACTGG + Intronic
1148460528 17:47836872-47836894 TCCCCAGCCATGGGCACCCCAGG - Exonic
1149475257 17:56955506-56955528 TCCCTACCCATTGCCTGCCAAGG + Intronic
1149637645 17:58183602-58183624 TCCCAACCCCTCGGCAGCCCTGG - Intergenic
1150170052 17:62985037-62985059 TCAACACCCACTGTCAGCGCTGG - Intergenic
1150393259 17:64802368-64802390 ACCCCACCCACTGTCATCTCTGG + Intergenic
1151427640 17:74041458-74041480 TCACCTCCCATTCTCACCCCAGG + Intergenic
1152031865 17:77847665-77847687 TCCCCACCCACTGAGAGCCTGGG - Intergenic
1152635558 17:81429246-81429268 CCCACACCCATCCTCAGCCCCGG - Intronic
1153369975 18:4304337-4304359 TCCCCACCCAAGGTAAGCACTGG - Intronic
1156474576 18:37397538-37397560 TCCCCACCCATGGACTCCCCAGG - Intronic
1156994541 18:43449556-43449578 TCCCCACCCCCTGACAGGCCCGG - Intergenic
1157409792 18:47454159-47454181 GCAACTCCCATTGTCAGCCCAGG - Intergenic
1158078936 18:53565590-53565612 TTCCCACCCATTGTCAGAGAGGG + Intergenic
1159042730 18:63340197-63340219 TCACCACCCTTTGTCAGCTCTGG + Intronic
1159233910 18:65646121-65646143 TCCCTACCCATTGTCACCTGAGG + Intergenic
1160746021 19:710867-710889 TCCCCACCCATTGTCAGCCCGGG - Intronic
1161216373 19:3096866-3096888 TCCCAACCCCCTGACAGCCCCGG - Intronic
1161389738 19:4014848-4014870 TCCCCTCCCATCTGCAGCCCTGG + Intronic
1163403957 19:17111010-17111032 CCCCCACCCACAGTCAGCACTGG + Intronic
1163635169 19:18434094-18434116 TCCCCACCCCATGTCTGCCCAGG + Intronic
1163700746 19:18785405-18785427 GCCCCGCCCATTCTCAGCCCGGG + Intronic
1164022737 19:21322836-21322858 ACACCACCCAGTGTCAGCACAGG + Intronic
1165111044 19:33502364-33502386 CCACCACCCCTTGACAGCCCAGG - Intronic
1165779910 19:38426230-38426252 TCCCCACCCACCCTCAGGCCAGG + Exonic
1166887609 19:45971649-45971671 ACCCCACCCACTGCCAGGCCTGG + Intronic
1168271363 19:55251509-55251531 TACACACCCATTGCCTGCCCAGG - Intronic
925118368 2:1398862-1398884 CCCCCACCCTCTGTCAGTCCTGG - Intronic
925174077 2:1770164-1770186 TCCTCAGCCATTCCCAGCCCTGG - Intergenic
925342024 2:3144656-3144678 TCCCCATCCATGCTCACCCCAGG + Intergenic
925749879 2:7078475-7078497 TCTCCACCTACTCTCAGCCCTGG - Intergenic
925937446 2:8778415-8778437 TCCCAACCTGTTCTCAGCCCAGG - Intronic
927918539 2:26952588-26952610 TCCCCACCCTGTGGCATCCCCGG - Intergenic
928111719 2:28515772-28515794 TCCCCACCCAATGCCTGCCCAGG - Intronic
928371243 2:30741699-30741721 GCCCCACCCAGTGTCATCCGGGG - Intronic
932572307 2:72944496-72944518 TCCCCTCCCCATGCCAGCCCAGG + Exonic
932598336 2:73107925-73107947 TGCCCACCAACTGTCTGCCCAGG + Intronic
934518754 2:95006137-95006159 TCTCCACCCCTTCTCTGCCCAGG - Intergenic
936514269 2:113172118-113172140 TCCCCAACATTTGCCAGCCCTGG + Intronic
937278410 2:120701284-120701306 TCCCCCGCCACTGTCACCCCAGG - Intergenic
942641544 2:178066485-178066507 TCCCCTCCCACTGCCTGCCCAGG + Intronic
944336217 2:198538564-198538586 CCCCCACCCCCTGACAGCCCCGG + Intronic
947834269 2:233164103-233164125 TTCCCACCCTTGGTCAGCCCCGG + Intronic
1168800983 20:643044-643066 ACCCCACCCTCTTTCAGCCCAGG + Intergenic
1169632338 20:7647510-7647532 GGCCCACCCATGGTCACCCCTGG - Intergenic
1170563603 20:17579861-17579883 TCTCCATGCATTGACAGCCCAGG - Intronic
1170812622 20:19686388-19686410 ACCCCACCCATTATCAGAGCAGG + Intronic
1172272975 20:33664732-33664754 TCCACACCCAATGCCACCCCTGG + Intronic
1173838278 20:46139623-46139645 GCCCCACCTAATGTGAGCCCGGG - Intergenic
1174756376 20:53162575-53162597 TCCACTGCCAGTGTCAGCCCAGG + Intronic
1175257882 20:57657869-57657891 TCCCCACACCTGGTGAGCCCCGG + Intronic
1175634859 20:60572438-60572460 TCCCCACCCCTTGACATCTCAGG - Intergenic
1176105159 20:63382432-63382454 TCCCCACCCATTTTACCCCCAGG + Intergenic
1179117499 21:38507451-38507473 TCCCCTCCCAGTGTCAGCACTGG - Intronic
1180205331 21:46256116-46256138 TCCCCACCCACTGGGAGGCCAGG + Intronic
1181316714 22:21975267-21975289 GCCCCAGGCATTGTCACCCCTGG - Intronic
1182137554 22:27919716-27919738 TCCCCAGCCCTTGGCAGCTCAGG + Intronic
1183405852 22:37630182-37630204 TCCCCACCCCATGCCAGCCATGG - Intronic
1184148128 22:42623365-42623387 TTCTCTCCCATTGTCAGCCCTGG - Intronic
1184409630 22:44319039-44319061 TCGCCTCTCATTGTCAGCCAGGG + Intergenic
1184444978 22:44541771-44541793 TCCCCACCCAAGATCTGCCCAGG + Intergenic
1185272677 22:49936027-49936049 TCCCCTCCCATGCTCAGCCCAGG - Intergenic
950449311 3:13056646-13056668 GCACCACCCATAGTCAGCTCAGG + Intronic
950720709 3:14880686-14880708 TCCCCATCCTGTGTAAGCCCAGG - Intronic
951345532 3:21543380-21543402 TCCCCACCCCTTGTCGCTCCTGG + Intronic
953374488 3:42417247-42417269 ACCCCAGCCAGTGGCAGCCCTGG + Intergenic
954214283 3:49115849-49115871 TCCCCACCCCCTGACAGGCCAGG - Exonic
955666541 3:61355300-61355322 TCTTCACCCATTGTCAGCTTTGG + Intergenic
956827940 3:73016309-73016331 TCTCTAGACATTGTCAGCCCTGG - Intronic
958184063 3:90097010-90097032 TCCCCACCCTATGACAGGCCCGG + Intergenic
960387307 3:117035812-117035834 TCCCCACCCACTGCCAGAGCAGG + Intronic
960846313 3:122007306-122007328 ACCCCACCCATAGCCTGCCCAGG - Intronic
961387041 3:126528613-126528635 TCCCTGCCCATGGCCAGCCCCGG - Intronic
967194135 3:187012067-187012089 TCCCCACTCACTGTTTGCCCAGG + Intronic
968568890 4:1329082-1329104 GCCCCGGCCACTGTCAGCCCTGG + Intronic
968861365 4:3173463-3173485 TCCCCACCCATTCAAAGCACAGG + Intronic
968925794 4:3547371-3547393 TCCCTGCCCAGTGTCAACCCAGG + Intergenic
969849193 4:9943215-9943237 TCCCCACTCACTCTGAGCCCTGG - Intronic
972370071 4:38414972-38414994 AGACCACCCACTGTCAGCCCAGG + Intergenic
975331807 4:73124454-73124476 TCCCCACCCTTTCTCAACTCTGG - Intronic
978168062 4:105632737-105632759 ACCCCACCCAATGCCAGCCCTGG + Intronic
978808494 4:112825176-112825198 TCCCCACCCCATGACAGGCCTGG - Intronic
988505910 5:31822951-31822973 ACCCCACCATTTGTCAACCCGGG + Intronic
992277682 5:75137001-75137023 CCCCCACCCCATGACAGCCCTGG - Intronic
994241215 5:97423736-97423758 TCTCAAGCCATTTTCAGCCCAGG - Intergenic
995905671 5:117119445-117119467 TACCCACCCCTTGTTAGCACAGG - Intergenic
997516778 5:134495644-134495666 CCCCCACCCATTCTTGGCCCAGG + Intergenic
998256337 5:140591567-140591589 TCTCCACCCACTGCCATCCCAGG - Intronic
999246734 5:150159005-150159027 TGCCCACCTACTCTCAGCCCAGG - Intergenic
999323264 5:150627439-150627461 TCCCAACCCATTGCTAGCCAGGG - Intronic
1000410127 5:160929147-160929169 TCTCCACCAATTGCCAGCCTGGG - Intergenic
1001280201 5:170381324-170381346 TTCCCTCCCATTGTCTGTCCTGG - Intronic
1001426094 5:171623676-171623698 TCCCCAGCCTTTGAAAGCCCAGG - Intergenic
1001930277 5:175668104-175668126 TCCCCACACAGTCCCAGCCCTGG - Intronic
1002026644 5:176400478-176400500 TCCCCACCCCTTGCCAGAGCTGG + Intronic
1002327271 5:178418006-178418028 GCCCCACTCACTGGCAGCCCAGG - Intronic
1002516965 5:179766053-179766075 TCCACACCTCTGGTCAGCCCCGG + Exonic
1003498110 6:6682249-6682271 TCCTCACCAACTGTCTGCCCAGG - Intergenic
1003637309 6:7844627-7844649 TCCCCACCAATGTTCAGCTCAGG + Intronic
1004452168 6:15757478-15757500 CCCCACCCCATTATCAGCCCTGG + Intergenic
1006962648 6:37949554-37949576 TCCCCACCAGTTGCAAGCCCAGG + Intronic
1007645577 6:43378008-43378030 TCCCCACCTGTTCTCATCCCAGG + Intergenic
1007664412 6:43505903-43505925 TCCCCACACCTTGGCAGCTCAGG + Exonic
1007710955 6:43824003-43824025 TGCACACCCACTGGCAGCCCTGG - Intergenic
1008560717 6:52722133-52722155 TCACTACCCAATGTCAGCCTCGG + Intergenic
1009192294 6:60643990-60644012 TCCACAGCCATTGCCAGCCCTGG - Intergenic
1017969582 6:159299868-159299890 TCACCACCCAGTCTCAGGCCAGG + Intergenic
1018098697 6:160417133-160417155 TCCCCACCCAGTGTCAGGCTTGG + Intronic
1019285838 7:222495-222517 TCCCCTCTCAGTGCCAGCCCTGG - Intronic
1019690631 7:2409188-2409210 TCCCCACACCTTCTCTGCCCAGG - Intronic
1021479150 7:21096501-21096523 TCCCCCTCCATTGCCAGCTCTGG + Intergenic
1023647732 7:42336763-42336785 TCCACACCCAGTGGCAGCGCTGG - Intergenic
1023750258 7:43365325-43365347 TCCCCACCCACTCTGAGGCCTGG + Intronic
1029156326 7:98520547-98520569 GCTCCACCCATTGCCAGCCAGGG - Intergenic
1029746086 7:102516537-102516559 TCCCCACCCCTTGGGCGCCCCGG - Intronic
1029764024 7:102615516-102615538 TCCCCACCCCTTGGGCGCCCCGG - Intronic
1029941502 7:104485008-104485030 TCCCCACCCAGTGTCACCTATGG - Intronic
1031399290 7:121312712-121312734 TCCTCACACATTGTCATCTCAGG - Intergenic
1034272852 7:149811783-149811805 TCCTCCCCCAGTCTCAGCCCTGG - Intergenic
1034343241 7:150371150-150371172 TCCCCTCCCAACCTCAGCCCCGG - Intronic
1035074489 7:156169098-156169120 ACCCCACCCACTGTCCCCCCAGG - Intergenic
1038319111 8:26512528-26512550 TCCAGTCCCATTGTCAGCCCAGG - Intronic
1041686658 8:60651649-60651671 TCCGCACCCATTTTGATCCCAGG + Intergenic
1045190106 8:99873446-99873468 TCCCAACCCTCTTTCAGCCCTGG - Intronic
1046599597 8:116300706-116300728 TCCCCTGCCATTATCAACCCAGG + Intergenic
1049413508 8:142484448-142484470 GCCCCACCCATGGGAAGCCCAGG - Intronic
1049446564 8:142634150-142634172 TCCCCTCCCATGGCCACCCCAGG - Intergenic
1049541846 8:143212237-143212259 ACCCCACCCATTGACAGTCGGGG + Intergenic
1051389864 9:16552477-16552499 TCCCCACCCACAGTCGGCCCCGG + Intronic
1052990042 9:34513788-34513810 ACCCCTCCCACTGGCAGCCCAGG + Intronic
1053800676 9:41762548-41762570 TCCCTGCCCAGTGTCAACCCAGG + Intergenic
1054144518 9:61552287-61552309 TCCCTGCCCAGTGTCAACCCAGG - Intergenic
1054189108 9:61974700-61974722 TCCCTGCCCAGTGTCAACCCAGG + Intergenic
1054649414 9:67613917-67613939 TCCCTGCCCAGTGTCAACCCAGG - Intergenic
1060820631 9:126659485-126659507 TCTCCACACATTCTCAGGCCAGG + Intronic
1190388667 X:49910384-49910406 TCCCCAGCCATATTCAGCTCTGG - Intergenic
1192152228 X:68719451-68719473 TCCCCAGGCAGGGTCAGCCCAGG + Intronic
1192261160 X:69506429-69506451 TGCCACCTCATTGTCAGCCCAGG - Intronic
1193044193 X:77034334-77034356 ACCCCACCCACTGTCAACACTGG + Intergenic
1196197504 X:112851533-112851555 TCCCCACCCACCGATAGCCCAGG - Intergenic
1198583678 X:138096167-138096189 TCCCCACCCACTGGCAGCCCTGG + Intergenic
1198618360 X:138481714-138481736 CCCACACCTATTGTCGGCCCTGG + Intergenic
1198935848 X:141902721-141902743 TCCCCACCTGTTGTCATCCCTGG + Intergenic
1198957578 X:142149170-142149192 GCCCCACCCACCGTCAGCCCTGG - Intergenic
1198963236 X:142204266-142204288 TACCCACCTATTGTCACTCCTGG - Intronic
1201457777 Y:14189249-14189271 TCCCCTCCCATTGACAGAGCAGG - Intergenic