ID: 1160750343

View in Genome Browser
Species Human (GRCh38)
Location 19:731148-731170
Sequence CGGGGCCGCCGCGTTCTCCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 86}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160750343_1160750354 14 Left 1160750343 19:731148-731170 CCAAGGAGAACGCGGCGGCCCCG 0: 1
1: 0
2: 2
3: 6
4: 86
Right 1160750354 19:731185-731207 CCCAGCCCCGAGTCCAGCCAAGG 0: 1
1: 0
2: 0
3: 40
4: 375
1160750343_1160750356 17 Left 1160750343 19:731148-731170 CCAAGGAGAACGCGGCGGCCCCG 0: 1
1: 0
2: 2
3: 6
4: 86
Right 1160750356 19:731188-731210 AGCCCCGAGTCCAGCCAAGGAGG 0: 1
1: 0
2: 0
3: 15
4: 157
1160750343_1160750345 -10 Left 1160750343 19:731148-731170 CCAAGGAGAACGCGGCGGCCCCG 0: 1
1: 0
2: 2
3: 6
4: 86
Right 1160750345 19:731161-731183 GGCGGCCCCGAGCCCAGTCCGGG 0: 1
1: 0
2: 2
3: 34
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160750343 Original CRISPR CGGGGCCGCCGCGTTCTCCT TGG (reversed) Exonic