ID: 1160753681

View in Genome Browser
Species Human (GRCh38)
Location 19:747220-747242
Sequence TCCCGGGGCCCTCTCTGGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 181}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160753681_1160753694 -3 Left 1160753681 19:747220-747242 CCCCGCCAGAGAGGGCCCCGGGA 0: 1
1: 0
2: 0
3: 19
4: 181
Right 1160753694 19:747240-747262 GGAGCCGGGGGTGGGTACTGAGG 0: 1
1: 0
2: 4
3: 59
4: 504
1160753681_1160753699 21 Left 1160753681 19:747220-747242 CCCCGCCAGAGAGGGCCCCGGGA 0: 1
1: 0
2: 0
3: 19
4: 181
Right 1160753699 19:747264-747286 CTGCTCAGGCCCTGGAAGTGAGG 0: 1
1: 1
2: 6
3: 33
4: 281
1160753681_1160753702 30 Left 1160753681 19:747220-747242 CCCCGCCAGAGAGGGCCCCGGGA 0: 1
1: 0
2: 0
3: 19
4: 181
Right 1160753702 19:747273-747295 CCCTGGAAGTGAGGCTCTATGGG 0: 1
1: 0
2: 0
3: 9
4: 103
1160753681_1160753700 29 Left 1160753681 19:747220-747242 CCCCGCCAGAGAGGGCCCCGGGA 0: 1
1: 0
2: 0
3: 19
4: 181
Right 1160753700 19:747272-747294 GCCCTGGAAGTGAGGCTCTATGG 0: 1
1: 0
2: 0
3: 18
4: 149
1160753681_1160753696 7 Left 1160753681 19:747220-747242 CCCCGCCAGAGAGGGCCCCGGGA 0: 1
1: 0
2: 0
3: 19
4: 181
Right 1160753696 19:747250-747272 GTGGGTACTGAGGCCTGCTCAGG 0: 1
1: 0
2: 1
3: 20
4: 184
1160753681_1160753697 13 Left 1160753681 19:747220-747242 CCCCGCCAGAGAGGGCCCCGGGA 0: 1
1: 0
2: 0
3: 19
4: 181
Right 1160753697 19:747256-747278 ACTGAGGCCTGCTCAGGCCCTGG 0: 1
1: 0
2: 3
3: 48
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160753681 Original CRISPR TCCCGGGGCCCTCTCTGGCG GGG (reversed) Exonic
900139889 1:1135183-1135205 TCCCAGGCCCCTCCCTGGGGAGG - Intergenic
900243817 1:1628809-1628831 TCCCTGGGCCATCACTGGAGGGG - Intronic
900531392 1:3155170-3155192 TCCCGGGGCCCTTCCTGGAGAGG - Intronic
900637889 1:3674766-3674788 TCCTGGGGCCCTCTGTGCCAAGG - Intronic
902382106 1:16057628-16057650 TCCATGGGCCCTCTCTGGCTGGG + Intergenic
903750321 1:25617171-25617193 TCCCGGCGCCCTCTCCGCGGCGG + Intergenic
903834034 1:26191181-26191203 TCCTGGGGCCCACTCTAGAGGGG - Intronic
903966832 1:27095977-27095999 CCCCGGCTCCCTCTCTGGCAGGG + Intergenic
905276480 1:36821770-36821792 TCCAGTGGCCCCCTCTGGCAAGG - Intronic
905408442 1:37753013-37753035 TCCCGCAGCCCTGCCTGGCGCGG + Exonic
905519870 1:38589429-38589451 GCCAGGGGACCTCTCTGGCCAGG + Intergenic
906458829 1:46021997-46022019 TCCCTTGTCCCTCTTTGGCGTGG - Exonic
907274781 1:53311126-53311148 TCCCGGGGGCCTCCCTGCCCTGG + Intronic
907442785 1:54489071-54489093 CCCCGGGGCGCTTCCTGGCGGGG + Intergenic
912336641 1:108868905-108868927 TCCTGGGGCCCTCTCAGTCTTGG + Intronic
913099025 1:115546129-115546151 TCCCGGGGGCCTCTCTGCTTGGG - Intergenic
915333047 1:155125549-155125571 TCGCTGGGCCCAGTCTGGCGGGG - Intergenic
920125967 1:203693970-203693992 TCCAGTGGCCCTCTGTGGGGTGG + Intronic
922784613 1:228276759-228276781 TCCCGGGGCCCCCTCGGGACAGG - Intronic
1062768366 10:82000-82022 TCCCTGGGCCCTGTGTGGCAAGG - Intergenic
1063703779 10:8410885-8410907 TTCTGGGGCCCACTCTGGAGAGG + Intergenic
1063907347 10:10794893-10794915 TCCCAGGGCGCTCTCTGCCAAGG + Intergenic
1065132879 10:22640515-22640537 TCCCGGAGCCCTTTGTGGGGCGG - Intronic
1069951025 10:72018172-72018194 TCCAGGGGGCAGCTCTGGCGTGG - Intergenic
1070277469 10:75020855-75020877 TCCAGGGACCCTTTCTGGTGTGG - Intronic
1072048595 10:91681575-91681597 TCCAGGGGCCCACGCTTGCGAGG + Intergenic
1075068035 10:119302807-119302829 TCCCTGGGGCCTCTCTGTCAGGG + Intronic
1075802428 10:125161262-125161284 TCCCGAGGGCCTCCCGGGCGGGG - Intergenic
1076370068 10:129946946-129946968 TCCCTGGGGCCTCGCTGGCCGGG + Intronic
1076535981 10:131178051-131178073 TCCCGGGGCTTTCTCAGGAGTGG + Intronic
1077007862 11:367434-367456 TCCAGGGTCGCTCTCTGGGGAGG - Intergenic
1078553158 11:12294152-12294174 TCCTGGGCCCCTCTCTGGGTTGG - Exonic
1081533498 11:43981362-43981384 TCCTGGGGCCTTCTCTGCCTGGG - Intergenic
1082028669 11:47589795-47589817 TCCCGGGCTCTTCTCTGGCCCGG + Exonic
1083342381 11:61967245-61967267 TCCCGGGGCGCGCGCTGGGGCGG - Intronic
1083582641 11:63834934-63834956 TACCAGGGCCTTCTCTGGCGAGG + Intergenic
1084181962 11:67451327-67451349 GCCCGGGGCCGCCTCTGGCGGGG + Exonic
1084336562 11:68461045-68461067 TCCCGGCGCCCGTCCTGGCGGGG - Intronic
1084717736 11:70884184-70884206 GCCCCGAGCCCTCTCTGGTGGGG - Intronic
1088342891 11:108788964-108788986 CCCCGGGGCTCTCTCAGGCAGGG + Intronic
1089329424 11:117679347-117679369 TCCCCTGACCCTCTCTGGGGAGG - Intronic
1090967622 11:131612857-131612879 ACCCGGGTCCCTCTGTGGCCTGG + Intronic
1091306792 11:134541522-134541544 CCACGGGGCCCTCTCGGCCGAGG - Intergenic
1092151065 12:6249120-6249142 TCCGGGAGCCCTCACTGGCATGG + Intergenic
1094199234 12:27780143-27780165 TCCCGGGGCCCGCTCCCGCGAGG - Exonic
1096614131 12:52822112-52822134 TCCCCCAGCCCTCTCTGGCATGG - Intronic
1096649302 12:53054087-53054109 TCCCGGGGAGCTCTGTTGCGGGG - Intronic
1096843185 12:54391283-54391305 TCCCGGGGGCCGTTCTGGCCGGG + Exonic
1098834583 12:75406865-75406887 TTCCTGAGCCCTCTCTGGCTAGG + Intronic
1100329804 12:93572096-93572118 TCCTGGTGCCCGCTCTGGCGGGG - Exonic
1101399896 12:104378191-104378213 GCCCGGGGCTCTCACTGGAGAGG - Intergenic
1102572170 12:113833492-113833514 TCCTGGGGCCTTGTCTGGCCTGG - Intronic
1104931278 12:132340690-132340712 TCCCCGGGCCCCTTCTGGGGTGG + Intergenic
1105280366 13:18959564-18959586 TCCACTGGCCCTCTCTGGCCTGG + Intergenic
1105294716 13:19077737-19077759 TCCAGTGGCCATCTCTGGAGAGG + Intergenic
1106225185 13:27780366-27780388 TCCCTGGGCCCTTTCTGGAATGG + Intergenic
1113331797 13:109334520-109334542 TCCCCTGCCCCTCTCTGGAGAGG + Intergenic
1113670424 13:112171960-112171982 TCCCTGAGCCCTCTCTGCCCTGG - Intergenic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1114064670 14:19051060-19051082 TCCCCCTGCCCTCTCTGGTGGGG - Intergenic
1114097591 14:19348942-19348964 TCCCCCTGCCCTCTCTGGTGGGG + Intergenic
1114980594 14:28158512-28158534 TCCTGGTGCCCACTCTGGGGTGG - Intergenic
1115753865 14:36515069-36515091 TCCTGGAGCCTCCTCTGGCGTGG - Intergenic
1119764699 14:77181242-77181264 TCCCTTGGCCCTCCCTGGTGGGG + Intronic
1122625670 14:103084309-103084331 TCCCGGGGCCCGCACTGCCGGGG - Intergenic
1122992059 14:105241120-105241142 TCCCGGGGCTGACTCTGGCCTGG - Intronic
1124625060 15:31302976-31302998 TCCCTGGGCTCTCTCTGCCAGGG + Intergenic
1124652393 15:31483563-31483585 GCCCGGGGCCCTACCGGGCGCGG - Exonic
1125604265 15:40931142-40931164 TCCCAGGGTCCTCTCTAGCCTGG + Intronic
1127961812 15:63895827-63895849 TCCTGGGGCCCTCTCTCCCCAGG + Intergenic
1128785743 15:70395614-70395636 ACCCGGGGCCCTCTCAGACAGGG - Intergenic
1131332955 15:91519049-91519071 TCCCTGGGCCTACTCTGGCTTGG - Intergenic
1132115205 15:99131038-99131060 TCCCAGCGCCCTCTCTGGAGGGG + Exonic
1132597510 16:760165-760187 CCCCCGGGCGCTCTCTGGCCTGG - Intronic
1133036447 16:3036569-3036591 TCCCGGGGACCTCCCTGACTTGG + Intronic
1136136405 16:28259186-28259208 GCCGGGGGCTCTGTCTGGCGGGG - Intergenic
1137530521 16:49276174-49276196 TCCCCAGGCCCTCTGGGGCGTGG + Intergenic
1138554672 16:57764545-57764567 TGCCTGGGGCCTCTCTGGCCTGG + Intronic
1139463703 16:67142607-67142629 TCCCGGTGCCTGCTCTGGGGAGG - Intronic
1142254067 16:89005652-89005674 TCCCAGAGTCCTCTCTGGGGAGG - Intergenic
1142847816 17:2690651-2690673 TCCTGGGGCCCCCGCTGGCGCGG + Exonic
1143687360 17:8528770-8528792 TCCCTTAGCCCTCTCTGGGGTGG + Intronic
1144737849 17:17564841-17564863 TCCCAAGGCCCTCCCTGGCCAGG - Intronic
1145747880 17:27333269-27333291 CCCCGGGTCCCTCTCTGGAGGGG - Intergenic
1145796847 17:27660564-27660586 TCCAGGTGCCCTGTCTGGTGGGG + Intergenic
1150302647 17:64059397-64059419 TCCCTGGGCCCTCCATGGCAGGG + Intronic
1150620434 17:66803790-66803812 TCCGAGGGCCCTCTCTGGGGAGG - Intronic
1150830127 17:68511892-68511914 GCCCGGGGCCCTCCCTTGCAGGG + Intronic
1151378275 17:73706801-73706823 TCCCGAGCCCCTCTCCGGCCAGG + Intergenic
1151509976 17:74552324-74552346 CCCCAGGGCCTTCTCTGTCGAGG + Intergenic
1152464060 17:80456037-80456059 TCCCGGGACCCCCTCTGCAGGGG - Intergenic
1152555884 17:81052935-81052957 TCCCTGGGCCCTTGCTGGCAGGG + Intronic
1152740108 17:82015022-82015044 TCCCGGGCCCTGCTCTGGCTGGG + Intronic
1160437634 18:78863463-78863485 TCCTCTGGCCCTCTCTGGGGAGG - Intergenic
1160499222 18:79394236-79394258 TCCCGAGGCCGGGTCTGGCGGGG - Intergenic
1160753681 19:747220-747242 TCCCGGGGCCCTCTCTGGCGGGG - Exonic
1160944435 19:1634638-1634660 TCCCCGGTCCCTCTCAGGAGGGG - Intronic
1161207238 19:3047370-3047392 TCCCGGGGCCCGCTGGGGGGCGG - Intronic
1161306810 19:3573200-3573222 TCCCGGGGCTCTCCATCGCGGGG + Intronic
1161456812 19:4373747-4373769 TCAGGGGGCCCTCTGTGGCCTGG - Intronic
1162376453 19:10308296-10308318 TTCCGGGGCCTTCTCTGGGGTGG + Exonic
1162396129 19:10418999-10419021 GCCGGGAGCCCCCTCTGGCGGGG + Intronic
1164741616 19:30580198-30580220 GCCCGGGGCTCTCTGTGGCCTGG - Intronic
1167391287 19:49196746-49196768 GCCCGGGGCCCCCGCTGGCGAGG - Exonic
1167501451 19:49851020-49851042 TCCTGCGGGCCTCTCCGGCGCGG - Intronic
1167898319 19:52599815-52599837 GACAGGGGCCCTCTCTGGTGAGG - Intronic
1167994784 19:53393635-53393657 TACAGGTGCCCTCTCTGGTGAGG - Intronic
925390692 2:3491946-3491968 TCCTAGGGCCCTCGCTGGCCAGG + Intergenic
925739547 2:6993589-6993611 TTCCAGGGCCCTCTGTGGAGCGG + Intronic
926341765 2:11909894-11909916 TCCGGGGGTCCTCCCTGGCAGGG + Intergenic
933971425 2:87472974-87472996 TCCGGGGGCCCTGCCTGGCCTGG - Intergenic
936322305 2:111477225-111477247 TCCGGGGGCCCTGCCTGGCCTGG + Intergenic
936517792 2:113193135-113193157 TCTTTGGGCCCTCTCTGGGGAGG + Intronic
937320250 2:120956658-120956680 TCCCGGAGCCCTGCCTGGGGTGG + Intronic
937856853 2:126678551-126678573 TCACGGAGCCCTCTCTGGCTAGG + Intronic
938481949 2:131670092-131670114 TCCCCCTGCCCTCTCTGGTGGGG - Intergenic
945466103 2:210171635-210171657 TCCCAGTGCCATCCCTGGCGAGG + Intergenic
946248145 2:218398686-218398708 TCCCGCGGGCCTCCGTGGCGGGG - Intronic
946495518 2:220192134-220192156 TCCTGGTGCCCTCTCTGGAGAGG + Intergenic
946495726 2:220193380-220193402 TCCTGGTGCCCTCTCTGGAGAGG - Intergenic
947668143 2:231919842-231919864 AGCCGGGGCACTCACTGGCGAGG + Intergenic
948187758 2:236034861-236034883 GCCATGGGCCCTCTCTGGCTGGG + Intronic
948368427 2:237473312-237473334 TGCAGGAGCCCTCTCTGGCCCGG - Intergenic
1171879290 20:30605081-30605103 TCCAGTGGCCATCTCTGGAGAGG + Intergenic
1172061511 20:32190122-32190144 TCCCGGGGCCCGCTGCGGGGTGG + Intergenic
1173865929 20:46312686-46312708 TCCCGGGTCCCTCTGGGGAGGGG - Intergenic
1175861496 20:62152461-62152483 TCCCGGTGGCGTCTCTGGCGCGG + Intronic
1175998377 20:62821363-62821385 TCCTGGTGCCCTCTCTGGGCTGG + Intronic
1180483158 22:15773682-15773704 TCCCCCTGCCCTCTCTGGTGGGG - Intergenic
1180871551 22:19149824-19149846 TTCCGGGGCGCTCCCGGGCGCGG - Exonic
1181656400 22:24303507-24303529 TGCTGGGGCTCTCTTTGGCGTGG + Intronic
1182087854 22:27573793-27573815 TCCTGGGGCCTTCTCAGGCTGGG + Intergenic
1183939520 22:41285569-41285591 GCCCGGGGCCCCCGCGGGCGTGG + Intronic
1185264967 22:49896493-49896515 TCCCCTGCTCCTCTCTGGCGTGG + Intergenic
950487427 3:13281808-13281830 ACCCGGGGCCCACTATGGCTTGG - Intergenic
950896917 3:16461006-16461028 GCCCGAGGGCCTCTGTGGCGTGG - Intronic
953884697 3:46708618-46708640 TCCCTGGGCTCTCCCTGGCTAGG - Intronic
954687975 3:52380734-52380756 TACTGGGGCCCTCCCTGACGGGG - Intronic
956622896 3:71238807-71238829 TCCCGGGTCCCTCCCTTGTGTGG - Intronic
959164493 3:102759356-102759378 TCCCGGAATCCTCTCTGGAGTGG - Intergenic
960141184 3:114153018-114153040 TCCCTGGGCCGTTTCTGGTGTGG + Intronic
961452583 3:127009068-127009090 TCCTGGGGGCCTCTCGGGCCAGG + Intronic
965523213 3:169689563-169689585 TCCAGGGGCCCTCTATGCTGGGG - Intergenic
968266435 3:197366957-197366979 TCCAGGCCCCCTCTGTGGCGAGG + Intergenic
968502727 4:958523-958545 TCCCTGGTCCATCTCTGGTGAGG - Exonic
968591616 4:1462504-1462526 TCTCGGGGCCTTCCCTGGCTGGG - Intergenic
969106467 4:4810570-4810592 TCTCGGGGCCCTGGCTGGCAAGG + Intergenic
969411314 4:7030125-7030147 TGCCCGTGCCCTCTCTGGCCTGG - Intronic
974686895 4:65242438-65242460 TCCTGGCGCCCACTCTGGTGAGG - Intergenic
982162977 4:152588409-152588431 TCCCAGGGCCCTCTCTAGCTTGG + Intergenic
985366581 4:189237485-189237507 TCACGGGGCCCTGTCTGCTGAGG + Intergenic
985527188 5:412002-412024 TCCCGGGGCCATCACCGGTGAGG - Intronic
985624969 5:980570-980592 TCCCGGGGGCCTCTGAGGCTGGG + Intronic
985987727 5:3531478-3531500 TCCTGGGGCCTTCTCTGCTGGGG - Intergenic
991654273 5:68887614-68887636 TCTCTGGGCCCACTCTGGCAAGG - Intergenic
997366060 5:133325793-133325815 TCCCCTGGGCCTCTCTGGGGGGG - Intronic
997529607 5:134573794-134573816 TCCCTGTGCCCTCTCTTGCGGGG + Intronic
998348437 5:141485056-141485078 TCCCCGCGCCAGCTCTGGCGCGG - Intronic
1002277825 5:178114655-178114677 TCCCAGGGCCCTCCCAGGCAGGG + Intronic
1002497041 5:179622897-179622919 ACCCGGGGCGCCCCCTGGCGAGG - Intronic
1004501816 6:16216688-16216710 TCTCGGCGCCTTCTCTGGCTGGG + Intergenic
1006836680 6:37003040-37003062 TCCCGATGCCCTCCCTGGCCTGG - Intergenic
1007180699 6:39927296-39927318 TTCCTGGGCCCTCTCTGGGCTGG - Intronic
1013226675 6:108124072-108124094 TCCCGGAGCTCTCCCTGGCAGGG - Intronic
1017652884 6:156599272-156599294 GCCTGGGGCCCTTTCTGGCCAGG - Intergenic
1017724823 6:157269614-157269636 TCCCAGGCCCCTCCCTGCCGTGG + Intergenic
1017786696 6:157762671-157762693 TCCCGGAGCCCGCTGTGGCTAGG + Intronic
1017834970 6:158168535-158168557 TCTCCGGGCCCTTCCTGGCGGGG + Intronic
1018612770 6:165661172-165661194 CCCCCGGGCCCACTGTGGCGTGG - Intronic
1019484637 7:1283958-1283980 GACCTGGGCCCTCTCTGGGGAGG + Intergenic
1019989668 7:4682610-4682632 GCCCGGGGCCGGCGCTGGCGCGG + Exonic
1024356277 7:48416638-48416660 TCCCGGGGCACTCTCCGACTGGG - Intronic
1025936784 7:66044173-66044195 TCCCGGGGCCCTCCCGGACAGGG + Intergenic
1028609772 7:92697627-92697649 TCCCGGGGGCTTCTCTGCAGTGG - Intronic
1030063460 7:105641291-105641313 GCTCGGAGCCCTCTCTGGCCAGG + Intronic
1031016984 7:116585934-116585956 TCCAGGGGCCCTCAGTGGCAAGG - Intergenic
1034319316 7:150164961-150164983 TCCTGGGGCCCCCTCTGTGGCGG + Intergenic
1039212996 8:35236549-35236571 TCCCGGCGCCTACTCTGGCTTGG + Intronic
1039479774 8:37863897-37863919 TTCCTGGGCCCCCTCTGGCTTGG - Intronic
1039630637 8:39107900-39107922 GCCCGGGGCCCTCCCTGTCTGGG + Intronic
1042625022 8:70748395-70748417 TCCTGGCGCCTTCTCTGGTGTGG + Intronic
1044692858 8:94896141-94896163 TCCCGGGCCCCGCTCCGGAGAGG - Intronic
1047526597 8:125639052-125639074 TCCCGGGGCCGTCTAAGGAGAGG - Intergenic
1049046830 8:140159056-140159078 TCCCGGGTCCGTCCCTGGCAGGG - Intronic
1049445482 8:142628644-142628666 TCCCAGGGACCTCTCTGTCTGGG - Intergenic
1052798509 9:32946258-32946280 TCCTGGGCACCTCTCTGGCCAGG + Intergenic
1054835513 9:69672059-69672081 TCCGGGGGCGCCCTTTGGCGAGG + Intronic
1056830321 9:89911879-89911901 TCCCGGGGCCCTCCATGGAAAGG + Intergenic
1056994514 9:91443627-91443649 TCCCAGTGCCCACTCTGGGGTGG - Intergenic
1057245545 9:93451725-93451747 TCCCAGGGCCATGTCTGGGGAGG - Exonic
1061271640 9:129547105-129547127 TCCTGGGGCCCTCTGGGGAGAGG - Intergenic
1061559828 9:131394763-131394785 TCGCGGGGCCGTTCCTGGCGCGG + Intronic
1061988694 9:134145684-134145706 TCCCTGTCCCCTCTCTGGCCAGG + Intronic
1203790862 EBV:150922-150944 TCCCGGGCTCTGCTCTGGCGCGG - Intergenic
1185838472 X:3367411-3367433 TCCTGGGCACCTCTCTGGCTAGG + Intergenic
1187871318 X:23767228-23767250 TCCTGGAGCCCACTCTGGGGTGG - Intergenic
1189233341 X:39469332-39469354 TCCCGGGGCCTTTTCTGCTGTGG - Intergenic
1190274660 X:48892042-48892064 TCCCTGGTCCCTCAGTGGCGTGG + Intergenic
1191016283 X:55813481-55813503 TCCCAGCGCCCACTCTGGGGTGG + Intergenic
1199723135 X:150557579-150557601 CCCCAGGACCCTCTCTGGAGAGG - Intergenic
1201237288 Y:11923485-11923507 TCCTGGGCACCTCTCTGGCTAGG - Intergenic