ID: 1160754750

View in Genome Browser
Species Human (GRCh38)
Location 19:751448-751470
Sequence CCTTGGAGGGCTCTGGGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160754750_1160754770 18 Left 1160754750 19:751448-751470 CCAAATCCCAGAGCCCTCCAAGG No data
Right 1160754770 19:751489-751511 CCCCATGGTCAGAGGCCAGAGGG 0: 1
1: 1
2: 4
3: 36
4: 246
1160754750_1160754768 17 Left 1160754750 19:751448-751470 CCAAATCCCAGAGCCCTCCAAGG No data
Right 1160754768 19:751488-751510 CCCCCATGGTCAGAGGCCAGAGG 0: 1
1: 0
2: 5
3: 17
4: 222
1160754750_1160754764 3 Left 1160754750 19:751448-751470 CCAAATCCCAGAGCCCTCCAAGG No data
Right 1160754764 19:751474-751496 GGGCCGGGTTGGCACCCCCATGG 0: 1
1: 0
2: 1
3: 11
4: 134
1160754750_1160754774 30 Left 1160754750 19:751448-751470 CCAAATCCCAGAGCCCTCCAAGG No data
Right 1160754774 19:751501-751523 AGGCCAGAGGGGCCCCTCCATGG 0: 1
1: 0
2: 2
3: 33
4: 326
1160754750_1160754772 19 Left 1160754750 19:751448-751470 CCAAATCCCAGAGCCCTCCAAGG No data
Right 1160754772 19:751490-751512 CCCATGGTCAGAGGCCAGAGGGG 0: 1
1: 0
2: 3
3: 29
4: 295
1160754750_1160754766 10 Left 1160754750 19:751448-751470 CCAAATCCCAGAGCCCTCCAAGG No data
Right 1160754766 19:751481-751503 GTTGGCACCCCCATGGTCAGAGG 0: 1
1: 0
2: 1
3: 6
4: 106
1160754750_1160754762 -8 Left 1160754750 19:751448-751470 CCAAATCCCAGAGCCCTCCAAGG No data
Right 1160754762 19:751463-751485 CTCCAAGGGAGGGGCCGGGTTGG 0: 1
1: 0
2: 0
3: 28
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160754750 Original CRISPR CCTTGGAGGGCTCTGGGATT TGG (reversed) Intronic
No off target data available for this crispr