ID: 1160760539

View in Genome Browser
Species Human (GRCh38)
Location 19:782060-782082
Sequence CAGGGAGGGAGAGACGGACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160760539_1160760549 5 Left 1160760539 19:782060-782082 CCCCGTCCGTCTCTCCCTCCCTG No data
Right 1160760549 19:782088-782110 CCTCTGTGAGCCACACCCTGCGG No data
1160760539_1160760556 26 Left 1160760539 19:782060-782082 CCCCGTCCGTCTCTCCCTCCCTG No data
Right 1160760556 19:782109-782131 GGCTGTCAGCGGCAGTGATGGGG No data
1160760539_1160760557 27 Left 1160760539 19:782060-782082 CCCCGTCCGTCTCTCCCTCCCTG No data
Right 1160760557 19:782110-782132 GCTGTCAGCGGCAGTGATGGGGG No data
1160760539_1160760554 24 Left 1160760539 19:782060-782082 CCCCGTCCGTCTCTCCCTCCCTG No data
Right 1160760554 19:782107-782129 GCGGCTGTCAGCGGCAGTGATGG No data
1160760539_1160760551 15 Left 1160760539 19:782060-782082 CCCCGTCCGTCTCTCCCTCCCTG No data
Right 1160760551 19:782098-782120 CCACACCCTGCGGCTGTCAGCGG No data
1160760539_1160760555 25 Left 1160760539 19:782060-782082 CCCCGTCCGTCTCTCCCTCCCTG No data
Right 1160760555 19:782108-782130 CGGCTGTCAGCGGCAGTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160760539 Original CRISPR CAGGGAGGGAGAGACGGACG GGG (reversed) Intergenic
No off target data available for this crispr