ID: 1160760725

View in Genome Browser
Species Human (GRCh38)
Location 19:782783-782805
Sequence GCTCCTGGACGTGGGTCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160760725_1160760732 14 Left 1160760725 19:782783-782805 CCCAAGGACCCACGTCCAGGAGC 0: 1
1: 0
2: 0
3: 9
4: 129
Right 1160760732 19:782820-782842 TGCAAACCAGACAACCCTGCAGG 0: 1
1: 0
2: 0
3: 11
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160760725 Original CRISPR GCTCCTGGACGTGGGTCCTT GGG (reversed) Intergenic
900601512 1:3504732-3504754 GCCCCTGCACGTGGATGCTTTGG - Intronic
901690491 1:10970006-10970028 GCCCCTCCACGTGGCTCCTTGGG + Exonic
901869701 1:12130748-12130770 GGTCCTGGACTTGTGTCCCTGGG + Intronic
902604564 1:17561631-17561653 GCTCCTTGGCGTAGGTCCCTGGG + Intronic
903124413 1:21238013-21238035 GCTCCTGGGCAGGGGACCTTAGG - Intronic
903650273 1:24917755-24917777 CTTCCTGGCTGTGGGTCCTTGGG - Intronic
904498522 1:30901089-30901111 GCTCCTGGCTGTGTGTGCTTTGG + Intronic
916792006 1:168133349-168133371 GTTCCTGGACGTGGGATCTGTGG - Intronic
922583979 1:226720042-226720064 GCTCCTGGAGCTGCCTCCTTAGG - Intronic
922699138 1:227748078-227748100 GCTCCTCGCCCCGGGTCCTTGGG - Exonic
923292681 1:232561857-232561879 GCACCTGGGCATGGGTACTTCGG + Intergenic
1067375889 10:45727422-45727444 GCTCCTGGTCGGGGGTCGTCCGG - Exonic
1067883592 10:50068110-50068132 GCTCCTGGTCGGGGGTCGTCCGG - Exonic
1069509925 10:69034660-69034682 GCTCCTGGAGGGAGGTCTTTGGG - Intergenic
1073922523 10:108475514-108475536 GCTCCTGGTTCTTGGTCCTTTGG - Intergenic
1074400927 10:113140792-113140814 CCTCCTGGAGGTGGGGCCTTGGG + Intronic
1074853443 10:117456672-117456694 GCTCCAGGATGTGTCTCCTTTGG + Intergenic
1077408998 11:2394897-2394919 GCACCTGGGTGTGTGTCCTTGGG + Intronic
1077919950 11:6634230-6634252 GGTGCTGGACTTGGGTCCTCCGG - Exonic
1078171785 11:8933672-8933694 ACCCCTGGAGGTGGGTACTTTGG - Intergenic
1079927944 11:26519698-26519720 GTTCTTGGAGGTGGGGCCTTTGG - Intronic
1083559356 11:63660226-63660248 GATGCTGGATGTGGGTCCTTTGG - Intronic
1084117910 11:67052634-67052656 GACCCTGGAGGTGTGTCCTTGGG - Intergenic
1084393947 11:68896749-68896771 GCTCCTGGTGGTGGGGCCCTAGG + Intronic
1084482235 11:69428666-69428688 GCTCCTGGCTGTGAGACCTTGGG - Intergenic
1084527384 11:69705324-69705346 GCTCCTGGATGTGGGGCCCCAGG + Intergenic
1086992380 11:93318154-93318176 CATCTTGGAAGTGGGTCCTTGGG + Intergenic
1094038925 12:26102611-26102633 GTATTTGGACGTGGGTCCTTTGG + Intergenic
1100450880 12:94705502-94705524 TATCCTGGACATGGGACCTTGGG - Intergenic
1102403775 12:112654457-112654479 GCTCCTAGAGGTGGTTCCTGAGG - Intronic
1103448784 12:121013179-121013201 GCTCCTGGAGGTGGGTAATGTGG + Intronic
1104517086 12:129437694-129437716 GCTCCTGAAGGTGTGTACTTAGG - Intronic
1109385288 13:61622357-61622379 GCTTCTGAACGTGGTTCCTGAGG - Intergenic
1110788256 13:79559264-79559286 GCTCCTGGTTGTTGGGCCTTTGG - Intergenic
1118469413 14:66061275-66061297 GCTCCTGGTCCTTGGGCCTTTGG - Intergenic
1121512736 14:94524321-94524343 GCTCCTGGACCTGGAACCTTGGG + Intergenic
1121680218 14:95787515-95787537 GCTCCTGGACCTCTGTCCCTGGG - Intergenic
1122039429 14:98973335-98973357 GCTCCCAGACATGGGTCCCTCGG + Intergenic
1122152529 14:99732685-99732707 GCTCCTGGCTGTGTGGCCTTGGG - Intergenic
1122944382 14:104999451-104999473 GCTCCAGCAGCTGGGTCCTTGGG - Intronic
1126101506 15:45120788-45120810 GCTGCTGCACGGGGGTCCCTAGG + Exonic
1127647634 15:60974161-60974183 GCTCCTTGACGTGGGTTCCACGG - Intronic
1127731414 15:61805732-61805754 GCTCCTAAACCTGGTTCCTTGGG + Intergenic
1128494402 15:68185480-68185502 GCTCCTAGATGTGGTTCCTGAGG + Intronic
1130313241 15:82772505-82772527 GCTCCAGGTTGTGGGTCCTCTGG + Intronic
1135415490 16:22265484-22265506 GCTCCTGGACGAGGGGCCCTGGG - Intronic
1135477563 16:22790212-22790234 GTACCTGGACCTGGGTACTTGGG - Intergenic
1136592066 16:31223544-31223566 GCTCCTTGACCTTGGGCCTTGGG + Intronic
1138874565 16:60934112-60934134 GCTCCTCAACATGGTTCCTTAGG + Intergenic
1142694740 17:1627664-1627686 GCTCCTGGAGCTGGGGCTTTGGG - Intronic
1142848327 17:2692558-2692580 GCTGCTGGACGTGAGTGCTGGGG - Exonic
1147210283 17:38869375-38869397 GCGCCTGGAGGCGGCTCCTTGGG + Intergenic
1151021040 17:70617704-70617726 GGGACTGGATGTGGGTCCTTGGG + Intergenic
1151236052 17:72720433-72720455 GCTCCTGGACCTGGGCCCCGAGG + Intronic
1151380152 17:73720165-73720187 GCTCCTGTAAGTGTGTCCTGAGG + Intergenic
1151852803 17:76701028-76701050 GCTCCTGGACCTGGGGCTGTGGG + Intronic
1152010707 17:77712124-77712146 GCTTTTGGAGGTGGGGCCTTTGG + Intergenic
1153240027 18:3022663-3022685 GTACCTGGAGGTGGGGCCTTTGG - Intergenic
1157590775 18:48835423-48835445 GCTCATGTACTTGGGTCCCTTGG + Intronic
1160760725 19:782783-782805 GCTCCTGGACGTGGGTCCTTGGG - Intergenic
1161750091 19:6089501-6089523 GCATCTGGAGGTGGGGCCTTTGG + Intronic
1164528465 19:29028968-29028990 GCTCCTGCACTAGGGTTCTTTGG - Intergenic
1165454484 19:35902769-35902791 GCTTCAGGGCCTGGGTCCTTGGG + Intronic
928114219 2:28535399-28535421 GCTCCTAGGCCTGGCTCCTTTGG + Intronic
928222035 2:29411757-29411779 GCTCCTAGAGGTGGTTCCTGAGG - Intronic
931567374 2:63628834-63628856 GGTCCTGGATCTGGGTTCTTAGG - Intronic
931710809 2:64988526-64988548 GCTCCTGGGCTTGTGTCCTGGGG - Intronic
932104344 2:68928892-68928914 GCACCAGGATTTGGGTCCTTTGG + Intergenic
936288077 2:111197089-111197111 GCTCCTGGAGGTGGTTCCATTGG + Intergenic
936797548 2:116224847-116224869 GGTCCTGGATCTGGGTCCTCTGG - Intergenic
938116876 2:128608290-128608312 GCTCCTGGACTTGGTGCCCTCGG - Intergenic
942049072 2:172121863-172121885 GCTCCTAGAGGTGGTTCCTGAGG + Intergenic
946178223 2:217934848-217934870 GCTCCTAGTCTTGGGGCCTTTGG - Intronic
1174487095 20:50868180-50868202 GCTGCTGGACGTGGGTCACCTGG + Intronic
1175296569 20:57912830-57912852 CCTCCTGGCTGTGCGTCCTTGGG + Intergenic
1175877767 20:62238579-62238601 TCACCTGGACGCGGGTCCCTCGG - Exonic
1176035174 20:63032620-63032642 GCTGCTGGACTTGGGGGCTTGGG + Intergenic
1176686914 21:9857270-9857292 TCTTATGGACCTGGGTCCTTGGG - Intergenic
1178137922 21:29649116-29649138 TCTCCTGGATGTGGCTACTTTGG - Intronic
1178439111 21:32584234-32584256 GCTCCTGGGCACGGGTCCTCTGG + Exonic
1181078006 22:20394288-20394310 GCTCCTGGCCGCGGAACCTTAGG + Exonic
1181390368 22:22576375-22576397 GCTCCTGGCCCTTGGTCCTCTGG - Intergenic
1181591052 22:23884797-23884819 GCTCCTCCACGTGGGGCCCTGGG - Exonic
1181964568 22:26647556-26647578 GCTCCTGGAAGTGTGTGCCTGGG + Intergenic
1182120413 22:27782733-27782755 GTTCCTGGCTGTGTGTCCTTGGG - Intronic
1182359367 22:29737788-29737810 GCTGCTGGATCGGGGTCCTTGGG - Intronic
1183060568 22:35334163-35334185 GCTGCTGGCTGTGGGGCCTTGGG - Intronic
1183679381 22:39318552-39318574 GCTCCCAGACATGGGTCCCTCGG - Exonic
950654362 3:14427574-14427596 GCTCCTGGCTGAAGGTCCTTGGG - Intronic
952198064 3:31096805-31096827 GCTCCTTCAAGTGGTTCCTTGGG - Intergenic
954392889 3:50276643-50276665 GCTCAGGGGCGTGGGTCCTCCGG - Exonic
955982233 3:64539008-64539030 GCTCCTGAAAGTGGGTCCTAAGG - Intronic
961481657 3:127184428-127184450 GCCCGTGCAGGTGGGTCCTTAGG + Intergenic
962394131 3:134999999-135000021 GCTCCTTGTCCTGGGTCCTCTGG + Intronic
963335215 3:143967424-143967446 GTATCTGGAGGTGGGTCCTTTGG + Intergenic
968518016 4:1022960-1022982 GCTCCTGGGTGTGGGGCCCTCGG + Intronic
969515815 4:7647741-7647763 TCTCCTGGCCGTGGTTCCTTGGG + Intronic
974664143 4:64936312-64936334 GTAGCTGGAGGTGGGTCCTTTGG - Intergenic
977418371 4:96764214-96764236 GCTCCTGGTAGTTGGTCCTCAGG + Intergenic
980350302 4:131675419-131675441 TCTTATGGACCTGGGTCCTTGGG - Intergenic
980659804 4:135842429-135842451 GCTCCTGGGCCTTGGGCCTTAGG - Intergenic
980907583 4:138963229-138963251 GCTCCTGGTTGTTGGGCCTTTGG - Intergenic
985493761 5:193373-193395 GCACCTAGAGGTGGGTCCTCAGG + Intronic
987659753 5:20856479-20856501 GTAGCTGGACGTGGGGCCTTTGG - Intergenic
988763890 5:34349168-34349190 GCAGCTGGACGTGGGGCCTTTGG + Intergenic
990960834 5:61391828-61391850 GCTCCCAGACATGGGTCCCTCGG - Intronic
993320231 5:86461624-86461646 GCTCCTGAACCTGGTTCCTGGGG - Intergenic
999136600 5:149324410-149324432 GCACTTGGAGGTGGGGCCTTTGG - Intronic
1002209007 5:177584758-177584780 ACTGCTGGACGTGGGTCTTGAGG - Intergenic
1005887809 6:30110435-30110457 GCTGCTGGAGGTGAGTCCCTTGG - Exonic
1009929828 6:70164016-70164038 GCTTTTGGAGGTGGGGCCTTTGG - Intronic
1013213306 6:108005525-108005547 GCTCCCAGACATGGGTCCCTCGG - Intergenic
1019146865 6:169981307-169981329 GCTGCTGGATGAGGGTCCTGTGG - Intergenic
1019170077 6:170128905-170128927 GCCCCTGCACGTGGGGCGTTCGG - Intergenic
1023838819 7:44084127-44084149 GCTTCTGTATGTGGGTCCTGAGG - Intergenic
1024361165 7:48470014-48470036 GCTGCTGGAGGAGGGTCATTTGG - Intronic
1024951655 7:54867205-54867227 GCCCCTGGAAGTGGGTTCCTGGG + Intergenic
1026583687 7:71638503-71638525 GCTTCTGGAAGAGGGTCCCTGGG + Intronic
1026979940 7:74520279-74520301 GGTCCTGGAAGTAGGTCCTGGGG + Intronic
1029112871 7:98222567-98222589 GGTCCTGGAGGTGGGGCCCTGGG - Intronic
1031977294 7:128102228-128102250 GAACCTGGAGGTGGCTCCTTGGG + Intergenic
1034890934 7:154838665-154838687 GGTCTTGCACGTGCGTCCTTAGG - Intronic
1038643822 8:29348002-29348024 GCTCCAGGACCTCGGCCCTTGGG - Intronic
1039393162 8:37198730-37198752 GATCCTGGAAGTGGGTCTCTGGG + Intergenic
1041030675 8:53732836-53732858 GCTCCTGAACCTGGTTCCTGGGG - Intronic
1042549231 8:69979463-69979485 GCTCCTGTAAGTAGGTCTTTGGG - Intergenic
1043225000 8:77715016-77715038 GATATTGGAAGTGGGTCCTTTGG - Intergenic
1048455255 8:134571953-134571975 GCTCCTGGAAATGTGTCCTAAGG + Intronic
1049144774 8:140991361-140991383 GCTCCTGGACTTGTGGCTTTTGG - Intronic
1049660204 8:143816323-143816345 GATCCTGGGCGTGTGTCCTTAGG - Exonic
1053782407 9:41624292-41624314 TCTTATGGACCTGGGTCCTTGGG + Intergenic
1054170362 9:61834449-61834471 TCTTATGGACCTGGGTCCTTGGG + Intergenic
1054667175 9:67746366-67746388 TCTTATGGACCTGGGTCCTTGGG - Intergenic
1056648744 9:88439015-88439037 GGGCCAGGAAGTGGGTCCTTAGG - Intronic
1057696087 9:97323894-97323916 GCTCTTGGACGTGCGTGCTGGGG + Exonic
1061344953 9:130016220-130016242 GTACCTGGAGGTGGGCCCTTTGG + Intronic
1062325177 9:136009448-136009470 CCCCCTGGACGTGGGCCCTGAGG + Exonic
1195589897 X:106612196-106612218 GATCCAGGACCTGGGCCCTTGGG - Exonic
1200887002 Y:8280478-8280500 GCTCCTGGATGTGGGGTTTTGGG + Intergenic