ID: 1160761683

View in Genome Browser
Species Human (GRCh38)
Location 19:788716-788738
Sequence TTTTATCCATGGCAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160761683_1160761691 30 Left 1160761683 19:788716-788738 CCTTCCACCTGCCATGGATAAAA No data
Right 1160761691 19:788769-788791 GTGTTCCCCAGAACAAGGCCTGG No data
1160761683_1160761688 0 Left 1160761683 19:788716-788738 CCTTCCACCTGCCATGGATAAAA No data
Right 1160761688 19:788739-788761 CGCCGAGTTCTAGAGGACACTGG No data
1160761683_1160761687 -7 Left 1160761683 19:788716-788738 CCTTCCACCTGCCATGGATAAAA No data
Right 1160761687 19:788732-788754 GATAAAACGCCGAGTTCTAGAGG No data
1160761683_1160761690 25 Left 1160761683 19:788716-788738 CCTTCCACCTGCCATGGATAAAA No data
Right 1160761690 19:788764-788786 ACAGAGTGTTCCCCAGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160761683 Original CRISPR TTTTATCCATGGCAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr