ID: 1160762281

View in Genome Browser
Species Human (GRCh38)
Location 19:791718-791740
Sequence GCTGAACTCCCCCGGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160762263_1160762281 23 Left 1160762263 19:791672-791694 CCACAGGGCCTCTTAGGGGACGG No data
Right 1160762281 19:791718-791740 GCTGAACTCCCCCGGGGGGAGGG No data
1160762262_1160762281 24 Left 1160762262 19:791671-791693 CCCACAGGGCCTCTTAGGGGACG No data
Right 1160762281 19:791718-791740 GCTGAACTCCCCCGGGGGGAGGG No data
1160762270_1160762281 15 Left 1160762270 19:791680-791702 CCTCTTAGGGGACGGGGGAGGGT No data
Right 1160762281 19:791718-791740 GCTGAACTCCCCCGGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160762281 Original CRISPR GCTGAACTCCCCCGGGGGGA GGG Intergenic
No off target data available for this crispr