ID: 1160763703

View in Genome Browser
Species Human (GRCh38)
Location 19:797951-797973
Sequence GGAAAGGCGCGCGCCCCCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160763703_1160763712 11 Left 1160763703 19:797951-797973 CCATCGGGGGCGCGCGCCTTTCC No data
Right 1160763712 19:797985-798007 CTCTGCCCCCGGCGCAGCCCCGG No data
1160763703_1160763708 0 Left 1160763703 19:797951-797973 CCATCGGGGGCGCGCGCCTTTCC No data
Right 1160763708 19:797974-797996 CGCCGCCCGGACTCTGCCCCCGG No data
1160763703_1160763718 23 Left 1160763703 19:797951-797973 CCATCGGGGGCGCGCGCCTTTCC No data
Right 1160763718 19:797997-798019 CGCAGCCCCGGAAGCGCAGGCGG No data
1160763703_1160763719 24 Left 1160763703 19:797951-797973 CCATCGGGGGCGCGCGCCTTTCC No data
Right 1160763719 19:797998-798020 GCAGCCCCGGAAGCGCAGGCGGG No data
1160763703_1160763723 29 Left 1160763703 19:797951-797973 CCATCGGGGGCGCGCGCCTTTCC No data
Right 1160763723 19:798003-798025 CCCGGAAGCGCAGGCGGGGCTGG No data
1160763703_1160763717 20 Left 1160763703 19:797951-797973 CCATCGGGGGCGCGCGCCTTTCC No data
Right 1160763717 19:797994-798016 CGGCGCAGCCCCGGAAGCGCAGG No data
1160763703_1160763720 25 Left 1160763703 19:797951-797973 CCATCGGGGGCGCGCGCCTTTCC No data
Right 1160763720 19:797999-798021 CAGCCCCGGAAGCGCAGGCGGGG No data
1160763703_1160763725 30 Left 1160763703 19:797951-797973 CCATCGGGGGCGCGCGCCTTTCC No data
Right 1160763725 19:798004-798026 CCGGAAGCGCAGGCGGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160763703 Original CRISPR GGAAAGGCGCGCGCCCCCGA TGG (reversed) Intronic