ID: 1160764479

View in Genome Browser
Species Human (GRCh38)
Location 19:801324-801346
Sequence CGGCGCCCCAGCAGAACGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160764479_1160764489 20 Left 1160764479 19:801324-801346 CCTTCCGTTCTGCTGGGGCGCCG No data
Right 1160764489 19:801367-801389 CTGTGCCGCCTGGGCAGGCATGG No data
1160764479_1160764484 10 Left 1160764479 19:801324-801346 CCTTCCGTTCTGCTGGGGCGCCG No data
Right 1160764484 19:801357-801379 CCAAGCCGGCCTGTGCCGCCTGG No data
1160764479_1160764481 -4 Left 1160764479 19:801324-801346 CCTTCCGTTCTGCTGGGGCGCCG No data
Right 1160764481 19:801343-801365 GCCGTTGAGCTGAGCCAAGCCGG No data
1160764479_1160764487 15 Left 1160764479 19:801324-801346 CCTTCCGTTCTGCTGGGGCGCCG No data
Right 1160764487 19:801362-801384 CCGGCCTGTGCCGCCTGGGCAGG No data
1160764479_1160764485 11 Left 1160764479 19:801324-801346 CCTTCCGTTCTGCTGGGGCGCCG No data
Right 1160764485 19:801358-801380 CAAGCCGGCCTGTGCCGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160764479 Original CRISPR CGGCGCCCCAGCAGAACGGA AGG (reversed) Intronic