ID: 1160764959

View in Genome Browser
Species Human (GRCh38)
Location 19:803462-803484
Sequence GGACCCCAGGCAGCCCAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 275}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160764948_1160764959 15 Left 1160764948 19:803424-803446 CCGTGGAAGTGTGGGTGTGGGTA 0: 1
1: 0
2: 3
3: 22
4: 272
Right 1160764959 19:803462-803484 GGACCCCAGGCAGCCCAAGTGGG 0: 1
1: 0
2: 2
3: 28
4: 275
1160764944_1160764959 20 Left 1160764944 19:803419-803441 CCCTGCCGTGGAAGTGTGGGTGT 0: 1
1: 0
2: 0
3: 10
4: 145
Right 1160764959 19:803462-803484 GGACCCCAGGCAGCCCAAGTGGG 0: 1
1: 0
2: 2
3: 28
4: 275
1160764945_1160764959 19 Left 1160764945 19:803420-803442 CCTGCCGTGGAAGTGTGGGTGTG 0: 1
1: 0
2: 1
3: 17
4: 207
Right 1160764959 19:803462-803484 GGACCCCAGGCAGCCCAAGTGGG 0: 1
1: 0
2: 2
3: 28
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160764959 Original CRISPR GGACCCCAGGCAGCCCAAGT GGG Intronic
900244763 1:1631884-1631906 GGGCCCCAGGCAGCCCGGGAAGG - Intergenic
900395431 1:2451460-2451482 TAACCCCTGGCAGCCCCAGTAGG + Intronic
900438726 1:2643121-2643143 AGCCCCCAGGCCGCCCCAGTGGG + Intronic
900602085 1:3507092-3507114 GGACCCCAGGCAGCCACACAGGG - Intronic
901405123 1:9040157-9040179 GGACCCCGGTCAGCCCCAGCAGG + Exonic
901658871 1:10786372-10786394 GGACCCCAGGCAGGCCAGAGAGG + Intronic
902460759 1:16574744-16574766 GGACCCCAGGGAGTCCTAGCTGG + Intronic
902461522 1:16581008-16581030 GGACCCCAGGGAGTCCTAGCTGG + Intronic
902462306 1:16587313-16587335 GGACCCCAGGGAGTCCTAGCTGG + Intronic
902960771 1:19961647-19961669 TGACCTAAGGCAGCCCTAGTAGG - Intergenic
903361091 1:22777740-22777762 GGAGGCCAGGCAGACTAAGTTGG + Intronic
903649401 1:24913768-24913790 GGACCCCAGGCTGGCCAGGCTGG - Intronic
904238341 1:29128146-29128168 GGAGCCCAGGCAGCCCAGATGGG - Intergenic
904431152 1:30465307-30465329 GGAGGCCTGGCAGCCCAAGTGGG - Intergenic
904558143 1:31378962-31378984 GGACCACAGGCAGCCAAGGAAGG - Intergenic
904952177 1:34251449-34251471 TGACCCCCGGCAGCCTAACTGGG + Intergenic
905169040 1:36099026-36099048 GGGCCCCAGGCAGCCCGGGCTGG + Exonic
906250517 1:44307536-44307558 GGCCCCCAGGGAACCGAAGTGGG - Intronic
906641093 1:47440788-47440810 GGCCCCTGGGCAGCCCAAGCAGG + Intergenic
907179143 1:52553823-52553845 GGACCCTCGGAAGCCCAAGCGGG + Intergenic
907926426 1:58958838-58958860 GAACCCCAAGCAGCCTAACTGGG + Intergenic
913603164 1:120441204-120441226 GGACCCCAGGGAGTCCTAGCTGG - Intergenic
913603912 1:120447556-120447578 GGACCCCAGGGAGTCCTAGCTGG - Intergenic
913604661 1:120453835-120453857 GGACCCCAGGGAGTCCTAGCTGG - Intergenic
913641533 1:120816548-120816570 GGACCCCAGGGAGTCCTAGCTGG - Intronic
913990412 1:143606768-143606790 GGACCCCAGGGAGTCCTAGCTGG + Intergenic
914083880 1:144435368-144435390 GGACCCCAGGGAGTCCTAGCTGG + Intronic
914189900 1:145400646-145400668 GGACCCCAGGGAGTCCTAGCTGG + Intronic
914211753 1:145586348-145586370 GGACCCCAGGGAGTCCTAGCTGG + Intergenic
914276949 1:146133780-146133802 GGACCCCAGGGAGTCCTAGCTGG + Intronic
914277700 1:146140072-146140094 GGACCCCAGGGAGTCCTAGCTGG + Intronic
914364341 1:146964819-146964841 GGACCCCAGGGAGTCCTAGCTGG - Intronic
914365860 1:146977392-146977414 GGACCCCAGGGAGTCCTAGCTGG - Intronic
914486583 1:148116050-148116072 GGACCCCAGGGAGTCCTAGCTGG + Intronic
914537993 1:148584728-148584750 GGACCCCAGGGAGTCCTAGCTGG + Intronic
914538746 1:148591020-148591042 GGACCCCAGGGAGTCCTAGCTGG + Intronic
914586912 1:149071191-149071213 GGACCCCAGGGAGTCCTAGCTGG + Intronic
914627928 1:149480605-149480627 GGACCCCAGGGAGTCCTAGCTGG - Intergenic
915510086 1:156382118-156382140 GGACCCCCGGCATCCCATGGAGG - Exonic
916759253 1:167801895-167801917 GAACTCCAGCCAGACCAAGTGGG + Intergenic
918836593 1:189474036-189474058 TGACCCCGGGCAGCCTAACTGGG - Intergenic
920074587 1:203327174-203327196 TGACTCCAGGCAGCCCGTGTGGG - Intergenic
923144317 1:231187237-231187259 TGGCCCCAGGCTCCCCAAGTGGG + Intronic
924443234 1:244104067-244104089 GGACCACAGGCTGCCTAAGGAGG + Intergenic
1063121169 10:3106487-3106509 GGCCCCCAGTCAGCCCCAGGTGG - Intronic
1063986555 10:11510475-11510497 GGACACCAGGCTGCCAAAGTTGG + Intronic
1064922133 10:20531114-20531136 TGACCCCAGGCAGCCTAACTGGG - Intergenic
1066687717 10:37996143-37996165 GACCCCCAGGCAGCCTAACTGGG + Intergenic
1066813552 10:39372539-39372561 GAACCCCAAGCAGCCTAACTGGG - Intergenic
1067576177 10:47409978-47410000 GGACTCCAGGGAGCCCAGGAAGG + Intergenic
1070167751 10:73911289-73911311 GGAGCCCGGGCAGCCCAGGGCGG - Exonic
1070537650 10:77391705-77391727 GGGCCCCAAACAGCCCAATTTGG - Intronic
1071508363 10:86246307-86246329 GGCCCTCAGGGAGCCCAGGTGGG - Intronic
1073052397 10:100676252-100676274 GGGCCGCATGCAGCCCAAGATGG + Intergenic
1074110503 10:110419422-110419444 GTAGCCAAGGCAGCCCCAGTGGG + Intergenic
1075615990 10:123891416-123891438 GGAGCCCAGGCCGCCCAAGAGGG - Exonic
1076417218 10:130300630-130300652 GGACCGCGGGCAGCCCAGGCTGG - Intergenic
1076417462 10:130301531-130301553 GGACCGCGGGCAGCCCAGGCTGG - Intergenic
1076853549 10:133104573-133104595 GGTCTCCAGGCAGCCCCAGGAGG - Intronic
1077863693 11:6205550-6205572 GAACCCCAGGCAGCCCAGGGAGG - Exonic
1078069188 11:8097171-8097193 GGACCCTAAGCAGCCCAAATTGG - Intronic
1081488263 11:43547907-43547929 GGAGCCCAGGGAGCCCGAGCTGG - Intergenic
1081877063 11:46415810-46415832 GTTCCCCAGGCAGCCCAAGATGG + Intronic
1082315156 11:50708709-50708731 GAACCCCAAGCAGCCTAACTGGG - Intergenic
1083007007 11:59356110-59356132 GAACTCCAGGCAGCCTAAGCTGG + Intergenic
1083928373 11:65823421-65823443 GGACCCCAGGCAGGCCAGTGGGG + Intronic
1084120377 11:67065750-67065772 CCACCCCAGGCAGGCCAAGGAGG + Intronic
1084474042 11:69378671-69378693 GGACCCCACGCAGCCTGAATTGG + Intergenic
1084535601 11:69754568-69754590 TGTCCCCAGGCAGCCCACATGGG - Intergenic
1084666097 11:70577152-70577174 GGAGCCCAGACAGCCCCAGGAGG + Intronic
1084756007 11:71239105-71239127 GGCCGCCAGGCAGGCCAAGAGGG + Intronic
1085047945 11:73364121-73364143 GGAGTTCAGGCAGCCAAAGTGGG - Intronic
1086616892 11:88831744-88831766 GGATCCCAAGCAGTCCAAGCTGG - Intronic
1089131710 11:116217602-116217624 GGTCCCCAGGGAGCCCTTGTGGG - Intergenic
1089891287 11:121883993-121884015 GGACCACATGCAGCCCAGGATGG + Intergenic
1091278441 11:134368364-134368386 GGACCACCTGCAGCCCAGGTCGG - Intronic
1093262332 12:16954121-16954143 GGGCCCCAGGCAGCCCAGGAGGG + Intergenic
1095991045 12:48034801-48034823 GAACCCCAGGCAGTCCACCTTGG - Intergenic
1096231320 12:49898343-49898365 GGTCCCCAGGGAGCCCCAGCCGG - Intronic
1096327596 12:50678689-50678711 AGACCCCAACCAGCCCAAGCCGG + Exonic
1096469286 12:51866013-51866035 AGACCCCAGCCAGCCCTAATGGG - Intergenic
1096976219 12:55700520-55700542 GGACCCCAGGAAGCCTGGGTTGG - Intronic
1097388482 12:58979797-58979819 GGACCCCAGGCTGACCCAGTTGG + Intergenic
1098595946 12:72273090-72273112 GGACTCCTGGCAGCCCGAGGCGG + Exonic
1098607112 12:72404399-72404421 GTTCCCCAGGCTGCCCAAGCTGG - Intronic
1100579307 12:95923391-95923413 GGACCCCAGACATCCCAATATGG + Intronic
1101328560 12:103738569-103738591 GGATCCCAGTCAGCCAAAGTAGG + Intronic
1101561984 12:105865289-105865311 GGACTCCAGGCTGCTCAAGCAGG + Intergenic
1102006900 12:109594981-109595003 TGGCCTCAGGCAGGCCAAGTGGG + Intronic
1102045909 12:109830157-109830179 TGACCCCAGGCACCCCAATGAGG + Intronic
1103232183 12:119340603-119340625 CGACTCCAGGCAGCCCAGCTGGG - Intronic
1103518918 12:121524891-121524913 GGACCTCAGGGGGCCCAAGAAGG + Intronic
1103623039 12:122200474-122200496 TGACCCCAGGCAGCCCGCCTGGG + Intronic
1105214880 13:18278250-18278272 GGACCCCAGGCAACGGAAGCAGG + Intergenic
1105833132 13:24183521-24183543 GGGCCACATGCAGCCCAAGATGG + Intronic
1106141450 13:27015254-27015276 GGCCCCCAGGCCGCCCAAAGCGG - Intergenic
1107486218 13:40829526-40829548 GACCCCCAGGCAGCCTAACTGGG + Intergenic
1110809017 13:79791378-79791400 GGACCCAAGGCAGCCCTCATGGG - Intergenic
1112771593 13:102799675-102799697 TGACCCCTGGCAGCCCAGGCCGG - Intronic
1113740365 13:112708724-112708746 GGGCCACACGCAGCCCACGTGGG - Intronic
1115027184 14:28759202-28759224 GGGGCCCAGGAGGCCCAAGTTGG + Intergenic
1115928789 14:38467542-38467564 GGAATCCAGGCAGCCCAGATGGG - Intergenic
1116094340 14:40348764-40348786 GACCCCCAGGCAGCCTAACTGGG + Intergenic
1117464185 14:55975823-55975845 GGAAAGCTGGCAGCCCAAGTTGG - Intergenic
1117875611 14:60248548-60248570 TGACCCCAGGAAGCCCAAGCAGG - Intronic
1118986585 14:70760892-70760914 GGATCCCAGGCACCTGAAGTAGG - Intronic
1119036092 14:71231435-71231457 GGAAGCCAGGCAGCGCAAGCAGG - Intergenic
1120709866 14:87781808-87781830 GAACCACAGGTAGCCCAGGTTGG + Intergenic
1121328335 14:93034575-93034597 GGCCCCCAGGCAGCTCAGGCTGG - Intronic
1121938922 14:98049090-98049112 AGACCCCTGGCAGCCAAAGGTGG + Intergenic
1122264162 14:100538974-100538996 GGCCCGCAGGAAGCCCACGTCGG + Exonic
1122875105 14:104660302-104660324 GGCACCCAGGGAGCCCAAATCGG - Intergenic
1122880051 14:104686717-104686739 GGACCCCAGGAAGCCCTTCTGGG + Intergenic
1122881733 14:104693355-104693377 GGCCCCCAGGCAGCCCTTGGTGG + Intronic
1122913361 14:104844419-104844441 GGACCCCAGGCAGAGGAAGCAGG - Intergenic
1126744881 15:51816156-51816178 GGACCCCAGTTGGCCCAAATAGG + Exonic
1128349968 15:66882029-66882051 GGGTCCCAGGAAGCCCCAGTAGG + Intergenic
1128664972 15:69531278-69531300 GGAGCCCAGGCAAACCAATTAGG + Intergenic
1129324701 15:74793935-74793957 GGGGCCCAGCCAGCCCTAGTGGG + Intronic
1129759957 15:78123618-78123640 GGAGCACAGCCAGCCCATGTGGG + Intronic
1129824335 15:78624921-78624943 GGATCCCAGGAAGCCCCAGTAGG - Exonic
1129898175 15:79123968-79123990 TGACCCCAGGAAGCCCTAATAGG + Intergenic
1130253760 15:82316424-82316446 GGACCCCAGGCAGCACTGATGGG - Intergenic
1130989256 15:88866114-88866136 TGCTCCCAGGCTGCCCAAGTTGG - Intronic
1133051772 16:3120958-3120980 GGACCACAGGCAGGCCATGGTGG - Intergenic
1134056016 16:11170346-11170368 GGACCCCAGGGAGCCCACGTGGG + Intronic
1135616197 16:23913132-23913154 GGACACCAGGCAGCCCTGGGAGG + Intronic
1135921066 16:26649386-26649408 TGATCCCAGGGAGCCCAAGTTGG - Intergenic
1137083701 16:36097333-36097355 GAACCCCAAGCAGCCTAACTGGG - Intergenic
1137304336 16:47183482-47183504 GACCCCCAGGCAGCCTAACTGGG + Intronic
1137609179 16:49807685-49807707 GGACCCCAGGCAGCTCCACCTGG + Intronic
1138030712 16:53557515-53557537 GGACCACATGCAGCCCAGGATGG - Intergenic
1138363158 16:56450468-56450490 GCATCCCAGGCACCACAAGTAGG - Intronic
1139472647 16:67186495-67186517 GCTCCCCAGGCAGCCCAAAGGGG - Intronic
1141480065 16:84300440-84300462 GGATCCCAGGAAGCCCCAGCTGG - Intronic
1141618989 16:85226725-85226747 GCACCACAGGCAGCCCAGGGAGG - Intergenic
1142903860 17:3029576-3029598 GTGCCCCAGGAAGCCCAGGTAGG - Intronic
1145046022 17:19616966-19616988 GGACAACAGGCAGCCCAAAGAGG + Intergenic
1145208360 17:20996360-20996382 GGACCCCAGGGTGGCCAAGAAGG + Intergenic
1146164152 17:30575006-30575028 GGTCCCCAGGCCGCCCCAGCAGG + Intergenic
1146990997 17:37272141-37272163 GGAGACCAGCCAGCCCAACTTGG + Intronic
1148051106 17:44770271-44770293 GACCCCCAGCCAGCCCACGTGGG + Intronic
1148221766 17:45867887-45867909 TGACCCCAGGCAACCCCAGAGGG + Intergenic
1148807682 17:50272466-50272488 AGAACCCTGGCAGCCCAAGTTGG + Intronic
1148908001 17:50923391-50923413 GGGGCCCAGGCAGCCCCTGTTGG + Intergenic
1151744178 17:76002658-76002680 GGACCCCACCCAACCCCAGTAGG - Intronic
1151786293 17:76276641-76276663 GGCCCCCAGGCACCTCACGTGGG - Intronic
1151890522 17:76948403-76948425 GGGACCCAGGCAGACCCAGTAGG - Intronic
1152225550 17:79091064-79091086 GGGGCCCAGGCAGCCCAGGATGG + Intronic
1153550090 18:6253420-6253442 GGACCTCAGCCAGTGCAAGTAGG + Intronic
1153931980 18:9886986-9887008 GAAGCCCAGCCAGCCCAAGGAGG + Exonic
1153932058 18:9887301-9887323 GAAGCCCAGCCAGCCCAAGGAGG + Exonic
1157449079 18:47772179-47772201 TGACCCCAGGCAGCCCAAGCGGG + Intergenic
1160501132 18:79401540-79401562 GGGCCACAGGCAGCCCGGGTGGG - Intronic
1160598422 18:79993978-79994000 GGTCCCCAGGCAGCACACTTTGG + Intronic
1160764959 19:803462-803484 GGACCCCAGGCAGCCCAAGTGGG + Intronic
1160793170 19:932409-932431 TCACCCCAGGAAGCCCAAATGGG + Exonic
1161060189 19:2210890-2210912 GGACCCCAGGCATCCGCACTCGG - Intronic
1161291619 19:3496748-3496770 GGACCCCAAGCAGCCCCTGCAGG - Exonic
1161946592 19:7441029-7441051 GGATCCCAGGGGCCCCAAGTGGG + Intronic
1162042165 19:7977608-7977630 GCAGCCCAGGCAGCCACAGTGGG - Intronic
1162904126 19:13813354-13813376 GGAGCAATGGCAGCCCAAGTGGG + Intronic
1164321567 19:24152973-24152995 GAACCCCAAGCAGCCTAACTGGG - Intergenic
1164792127 19:30996345-30996367 TGACCCCAGGAAGCACCAGTAGG + Intergenic
1165346965 19:35254543-35254565 GGACCCCAAGGAGCCCGAGGAGG - Intronic
1166782231 19:45348741-45348763 GGGCCCCAGGGAGACGAAGTGGG + Intronic
1166872078 19:45877016-45877038 GGGCCTCAGGCCGCCCCAGTGGG + Intergenic
1166977661 19:46614201-46614223 GGATCCCAGGCGGCCCTGGTTGG - Intergenic
1167000317 19:46741902-46741924 GGCCCCCAGGAAGCTGAAGTGGG + Intronic
1167272094 19:48511514-48511536 GGACGCCAGGCAGCCGGAGGCGG + Exonic
1167300030 19:48672828-48672850 GGACCCCAGGCCGCCCAGGCAGG - Intronic
1168320044 19:55503699-55503721 GAAACCCAGGCAGCCCCAGACGG - Intronic
1202653445 1_KI270707v1_random:26794-26816 GGCCCCCAAGCAGCCTAATTGGG + Intergenic
1202677959 1_KI270711v1_random:24755-24777 GGACCCCAGGGAGTCCTAGCTGG + Intergenic
925231070 2:2234552-2234574 GGAACCCCTGCAGCTCAAGTTGG + Intronic
925278663 2:2668383-2668405 TGACTCCAGGCAGCCCTACTCGG - Intergenic
925470784 2:4158518-4158540 GAACCCCAAGCAGCCTAACTGGG + Intergenic
928315666 2:30243433-30243455 GAACCCCAGGAAAGCCAAGTTGG - Intronic
929094909 2:38254288-38254310 TGGCCCCAGGCAGGCCAAGTGGG - Intergenic
932343053 2:70978798-70978820 GGAGTCCAAGCAGCCCAGGTGGG + Exonic
932450912 2:71810333-71810355 GGACCCCTGGGAGCCCATGGGGG - Intergenic
934251044 2:90355759-90355781 GAACCCCAAGCAGCCCAACTGGG - Intergenic
934258518 2:91447651-91447673 GAACCCCAAGCAGCCCAACTGGG + Intergenic
934299441 2:91768487-91768509 GGACCCCAGGCAACGGAAGCAGG - Intergenic
934760654 2:96854355-96854377 GGACCCAAGTCAGCCCGACTCGG - Exonic
934831118 2:97526122-97526144 TGACCCCAAGCAGCCTAACTGGG + Intronic
943356008 2:186856811-186856833 GGGCCACATGCAGCCCAGGTGGG - Intergenic
947841066 2:233208345-233208367 AGAGGCCAGGCAGCCCAAGGTGG - Intergenic
948468114 2:238161851-238161873 AGAACCCAGGCAGCCCCAGGGGG + Intronic
948992349 2:241561485-241561507 GGGGCCCAGCCAGCCCAGGTGGG + Intronic
948992383 2:241561587-241561609 GGGGCCCAGCCAGCCCAGGTGGG + Intronic
948992417 2:241561689-241561711 GGGGCCCAGCCAGCCCAGGTGGG + Intronic
1169332139 20:4724489-4724511 GGAGCCCAGGCAGGCCTGGTGGG + Intronic
1170090343 20:12583215-12583237 GAACCCCAAGCAGCCTAACTGGG + Intergenic
1170253724 20:14316483-14316505 GGGCCACAGGCAGCCCAGGATGG + Intronic
1170613709 20:17933348-17933370 TGGCCCCAGGAAGCCCCAGTAGG + Intergenic
1170765681 20:19288434-19288456 GCAGCCCAGGCAGCCTAATTTGG + Intronic
1174297933 20:49562171-49562193 GGCCCCCAGTCACCCTAAGTGGG + Intronic
1176322728 21:5349328-5349350 GGACCCCGAGCAGCCTAACTGGG + Intergenic
1176480382 21:7280948-7280970 GGACCCCGAGCAGCCTAACTGGG + Intergenic
1180523890 22:16235753-16235775 TGACCCCAAGCAGCCTAACTGGG + Intergenic
1181432125 22:22888057-22888079 AGACCCAAGACAGGCCAAGTGGG + Exonic
1181697795 22:24602589-24602611 GGACCCCAGGCAACGGAAGCAGG - Intronic
1183209405 22:36441623-36441645 GGACCCCAGGCAGTCCCATGCGG + Intergenic
1183303404 22:37069521-37069543 GGAACCCAGGCAGGCCGAGTGGG - Intronic
1184661357 22:45967054-45967076 GGGCCCCAGGCAGGCTGAGTGGG + Intronic
1184676388 22:46045448-46045470 GGACCCCCGACAGCACAAGGAGG + Intergenic
1184688413 22:46106694-46106716 GGACCCCAGACAGCCCTGGAAGG + Intronic
1185085230 22:48737347-48737369 GGACCCCGAGCTGCCCTAGTGGG + Intronic
1185110461 22:48897599-48897621 GGACCCCAGGCAGCCCTGTGGGG - Intergenic
1185276088 22:49950712-49950734 GGACCCCCGGCAGCTCCAGCAGG - Intergenic
950964056 3:17134034-17134056 TGACCCCAGGAAGCCCCATTAGG + Intergenic
954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG + Intronic
954460472 3:50623868-50623890 GGAGCCCTGGCAGCCCCAGCTGG + Intronic
956738778 3:72258925-72258947 GGAGGGCAGGCAGCCCAAGGAGG + Intergenic
959763949 3:110001802-110001824 GGCCCCCATGTAGCCTAAGTGGG - Intergenic
959984909 3:112561740-112561762 GCACCCCAGGCAGCCCGCGACGG + Exonic
960536096 3:118815998-118816020 GGTCACCAGGCAGCACAACTGGG + Intergenic
962092077 3:132254922-132254944 GGACCCCAGGAAGGCCACATTGG - Intronic
962375464 3:134855358-134855380 GGACCAGAGGCAGCCCATGCAGG - Intronic
965355899 3:167672588-167672610 GGACCACATGTAGCCCAAGATGG + Intergenic
965964091 3:174466199-174466221 GGCCCACATGCAGCCCAAGACGG + Intronic
966662199 3:182426798-182426820 TGACCCCAAGCAGCCTAACTGGG + Intergenic
966694680 3:182777789-182777811 GGTCTCCAGGCAGCCCAAAAGGG + Intergenic
968078435 3:195829925-195829947 GGACCCCAGCCAGCCCTCATGGG - Intergenic
968541045 4:1168603-1168625 GGGCCCCGGGCAGCCCACCTGGG + Intronic
968816480 4:2824263-2824285 GTACCCCAGGGAGGCCAAGCAGG + Intronic
974741567 4:66014068-66014090 GGAATCCAGGCAGCCCAGATGGG - Intergenic
978941192 4:114437764-114437786 GGACCACATGCAGCCCAGGATGG + Intergenic
983216616 4:165008097-165008119 GGATCAGAGGCAGCCCCAGTGGG + Intergenic
984142846 4:176024167-176024189 GCAGCACAGGTAGCCCAAGTGGG + Intergenic
984626155 4:182009705-182009727 AGACCCCAGGCAGCCACAGCTGG + Intergenic
984859278 4:184221833-184221855 GGTCCCAAGTCAGCCCATGTCGG + Intergenic
985202792 4:187501919-187501941 GGACGCCAGGCTGCCCCAGATGG - Intergenic
985536770 5:469447-469469 GGGCCCCAGGCAGTGCAGGTGGG + Intronic
985705923 5:1401351-1401373 GGCCCCGAGGCAGCCCACCTGGG - Intronic
985760531 5:1746479-1746501 GGTCCCCGGGCAGCCCAGGCAGG - Intergenic
985816394 5:2131212-2131234 GGACCCCAGGAAGCCCACACTGG - Intergenic
985850833 5:2388135-2388157 TGTCCCCAGGTAGCACAAGTTGG + Intergenic
989940668 5:50146158-50146180 GACCCCCAGGCAGCCTAACTGGG + Intergenic
989942825 5:50174237-50174259 GACCCCCAAGCAGCCTAAGTAGG - Intergenic
990471609 5:56121043-56121065 GGACCACAGGCAGGCCAAGATGG + Intronic
993253384 5:85556540-85556562 GGACAGCAGGCAGCCATAGTGGG - Intergenic
995456030 5:112353499-112353521 AGTCCCCAGGCAGCACAGGTAGG + Intronic
996754273 5:126919799-126919821 GGACGCCAGGCAGCCAATGAGGG - Intronic
998092666 5:139380320-139380342 GGGCCCCAGGCAGCCCCAGCAGG + Exonic
1002967279 6:1978659-1978681 GGCCCACAGGCAGCCCAAACAGG - Intronic
1006183274 6:32166639-32166661 GGACCCCAAGAACCCCAACTAGG + Intronic
1007595416 6:43048166-43048188 GGACCGCAGGCAGGCCATGCAGG + Exonic
1007740480 6:44006568-44006590 TGACCCCAGGAAGCCCAAGGCGG + Intergenic
1011129441 6:84038170-84038192 GGGCCCCTGGCAGCAGAAGTAGG + Intronic
1014403958 6:121025263-121025285 GGAGGCCATGCAGCCCAGGTTGG - Intergenic
1016425810 6:143934860-143934882 GGACCCCAGGTAGCATACGTGGG + Intronic
1017587961 6:155947468-155947490 GGCCCACAGGCAGCCACAGTGGG - Intergenic
1018068120 6:160137794-160137816 GGAACCCAGGGTGCCCAAGATGG - Intronic
1019734094 7:2641930-2641952 GGGACCCGGGCAGCCCAAGTGGG + Intronic
1019747655 7:2709562-2709584 GATCCCCAGGCAGCCCCAGCAGG - Intronic
1019782456 7:2951626-2951648 GGAACCCAGGAAGCAGAAGTTGG - Intronic
1019974975 7:4573885-4573907 GGTCCTCAGGCACCCCAGGTGGG + Intergenic
1021939801 7:25668454-25668476 GTAGCCCAGGGAGCCCAAGGGGG - Intergenic
1022811557 7:33873594-33873616 TGAGCCCAGGCAGCCAAAGTGGG - Intergenic
1023721148 7:43096106-43096128 GGGCCCCATGCAGCCCAGGATGG - Intergenic
1023842826 7:44106628-44106650 GTCCCCCAGGCCGCCCAAGAAGG + Exonic
1023907983 7:44535778-44535800 GGACCCCAGGCATCTTCAGTAGG - Intronic
1024423250 7:49194800-49194822 GGATCTCAGGCAGCCCAAGCTGG + Intergenic
1024961695 7:54982949-54982971 GGACCCCTGGCATCAGAAGTCGG - Intergenic
1026498774 7:70925301-70925323 TGACCTCACACAGCCCAAGTCGG + Intergenic
1026841296 7:73671218-73671240 GGCCCCCGGGCGGCCCCAGTGGG - Exonic
1029659208 7:101948084-101948106 GGACGCCAGGCAGCCAGATTCGG + Intronic
1032793798 7:135261518-135261540 TGTCCCCAGGCAGCCAAAGCAGG - Intergenic
1033241035 7:139680321-139680343 GGTGCCCAAGCAGCCCCAGTAGG + Intronic
1033418383 7:141184578-141184600 ACACCCAAGGCAGCACAAGTAGG - Intronic
1035050410 7:155995563-155995585 GGACACCAGGCAGCCACTGTGGG - Intergenic
1035599991 8:891763-891785 GGATCCCAGCCAGCCCAGGACGG + Intergenic
1039869349 8:41532442-41532464 GCAACTCAGGAAGCCCAAGTGGG + Intronic
1047588194 8:126297600-126297622 GGGCCACAGGCAGCCCAGGACGG - Intergenic
1049113938 8:140669629-140669651 GGAAAGCAGGAAGCCCAAGTGGG - Intronic
1049612273 8:143561178-143561200 GGGCCCACGGCAGCCCAAGCTGG - Intronic
1049926979 9:418957-418979 GGACCCCAGGGAGCCTAAGGAGG + Intronic
1052410612 9:28117207-28117229 GAACCCCGGGCAGCCTAACTGGG - Intronic
1052429545 9:28348844-28348866 GAACCCCGGGCAGCCTAACTGGG + Intronic
1054311328 9:63480500-63480522 GACCCCCAAGCAGCCCAACTGGG - Intergenic
1055429023 9:76225515-76225537 GGACCCAAGGCAGACTCAGTGGG - Intronic
1056558597 9:87710296-87710318 AGACCTCAGGCACCCCAAGGTGG - Intergenic
1057314795 9:93961272-93961294 GCTCCCCAGGCTGCCCAAGCTGG - Intergenic
1058727003 9:107813966-107813988 GGGCCGCATGCAGCCCAAGATGG - Intergenic
1060216815 9:121743485-121743507 AGACCCCAGCAGGCCCAAGTAGG + Intronic
1060230230 9:121820518-121820540 GGACCCCAGGCAGCCCCGAGCGG + Intergenic
1060794879 9:126506761-126506783 GGGTGCCAGGCAGCCCAAGCAGG - Exonic
1061043226 9:128151406-128151428 GGGCCCCAGGCAGGCCAGGAGGG + Intronic
1061486584 9:130923486-130923508 GGATCTCAGGGAGCCCAAGGTGG + Intronic
1186340141 X:8636263-8636285 GGACACCAGGCCACCCAACTTGG - Intronic
1186611991 X:11146405-11146427 TGACCCCAGCCATCCCAAGGAGG - Intronic
1186839439 X:13470290-13470312 GGACCCCAGGCAAGCCACATGGG + Intergenic
1187960905 X:24565188-24565210 AGACCCCAGGCAGCACAGGCAGG - Intronic
1189182254 X:39015548-39015570 GGACCCCAGAAAGCCAAGGTAGG - Intergenic
1190213018 X:48462278-48462300 GTACCCCAGGTAGCCTAAGAGGG + Exonic
1191680964 X:63839349-63839371 GGCCCCCAAGCAGCCTAACTGGG + Intergenic
1195436076 X:104844695-104844717 GGACCACATGCAGCCCAAGATGG - Intronic
1197869492 X:131051532-131051554 AGAACCCAGGAAGCCAAAGTGGG + Intergenic
1198005552 X:132489573-132489595 CGACCCCAGGCAGCCCGGGCTGG + Intronic
1200229060 X:154435033-154435055 GGACCCAAGGCAGCTTAGGTAGG + Intronic
1201710449 Y:16985749-16985771 TGACCCCAAGCAGCCTAACTGGG + Intergenic
1202078971 Y:21064449-21064471 GGACCCCGAGCAGCCTAACTGGG + Intergenic
1202356731 Y:24059328-24059350 GGCCCCCAGGTAGCCTAACTGGG + Intergenic
1202514047 Y:25610782-25610804 GGCCCCCAGGTAGCCTAACTGGG - Intergenic