ID: 1160765117

View in Genome Browser
Species Human (GRCh38)
Location 19:804209-804231
Sequence GTACCTGAGCCGCGTTTCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 31}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160765107_1160765117 25 Left 1160765107 19:804161-804183 CCCTTTGGGAAGGTCACCAACCT 0: 1
1: 0
2: 1
3: 16
4: 173
Right 1160765117 19:804209-804231 GTACCTGAGCCGCGTTTCTCCGG 0: 1
1: 0
2: 0
3: 2
4: 31
1160765113_1160765117 5 Left 1160765113 19:804181-804203 CCTCCTGATGCTGAAGGGGAAAA 0: 2
1: 0
2: 1
3: 28
4: 221
Right 1160765117 19:804209-804231 GTACCTGAGCCGCGTTTCTCCGG 0: 1
1: 0
2: 0
3: 2
4: 31
1160765114_1160765117 2 Left 1160765114 19:804184-804206 CCTGATGCTGAAGGGGAAAAACC 0: 2
1: 0
2: 1
3: 8
4: 211
Right 1160765117 19:804209-804231 GTACCTGAGCCGCGTTTCTCCGG 0: 1
1: 0
2: 0
3: 2
4: 31
1160765108_1160765117 24 Left 1160765108 19:804162-804184 CCTTTGGGAAGGTCACCAACCTC 0: 1
1: 0
2: 1
3: 32
4: 572
Right 1160765117 19:804209-804231 GTACCTGAGCCGCGTTTCTCCGG 0: 1
1: 0
2: 0
3: 2
4: 31
1160765111_1160765117 9 Left 1160765111 19:804177-804199 CCAACCTCCTGATGCTGAAGGGG 0: 1
1: 0
2: 1
3: 19
4: 178
Right 1160765117 19:804209-804231 GTACCTGAGCCGCGTTTCTCCGG 0: 1
1: 0
2: 0
3: 2
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160765117 Original CRISPR GTACCTGAGCCGCGTTTCTC CGG Intronic
903998275 1:27322074-27322096 GAATCCGAGCCGCGTTCCTCTGG - Intergenic
1070735314 10:78859915-78859937 GTCCCTGAGCCCCGGTGCTCTGG - Intergenic
1103561156 12:121793850-121793872 GCAGCTGAGCCCCGTTTTTCCGG - Exonic
1103659644 12:122503366-122503388 GTACCTGAGATGGGGTTCTCAGG - Intergenic
1113789317 13:113019187-113019209 GCAGCTGAGCCGCAGTTCTCAGG + Intronic
1129780242 15:78264974-78264996 AAACCTGAGCCGCGTTTGTTGGG + Intronic
1148134536 17:45283834-45283856 GGACCTAAGGCGCGTTTCTGTGG - Intronic
1160765117 19:804209-804231 GTACCTGAGCCGCGTTTCTCCGG + Intronic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1160879485 19:1313007-1313029 GTGCCTGAGCCCCATTTCTCTGG + Intergenic
930476242 2:51886214-51886236 GTACCTGAGCCGAAGTTCTAGGG - Intergenic
944154088 2:196593016-196593038 GCCCCTGCGCCGCGTCTCTCCGG - Intronic
947722524 2:232378568-232378590 CAACCTGAGCTGCCTTTCTCAGG + Exonic
947990782 2:234485789-234485811 GTGCCTCAGCCATGTTTCTCTGG - Intergenic
1170771341 20:19335531-19335553 TTACCTGAGCAGCCTTTATCTGG - Intronic
1171087480 20:22251028-22251050 GTACCTGAGCTGTGTGACTCTGG + Intergenic
1178575847 21:33789806-33789828 AAACCTGAGCCACATTTCTCAGG + Intronic
1179265678 21:39800670-39800692 GAACCTGAGCTGCCATTCTCAGG + Intronic
1181613555 22:24036163-24036185 GTACCTGAGCCTCCTTTGTCTGG - Exonic
953564769 3:44022063-44022085 GTAACGGAGCCGCGCTCCTCGGG + Intergenic
962793816 3:138834371-138834393 GTTCCTGAGGGGCGTTTCTGTGG - Intronic
964276940 3:155018890-155018912 GTTCCTGAGCCTCCTCTCTCGGG - Intergenic
972635915 4:40883915-40883937 GTTCCTGAGCCTCGTTTTTGTGG - Intronic
977090526 4:92669395-92669417 GTACCTGAGCAGCGATCCTATGG + Intronic
990382978 5:55233697-55233719 GCACCGGAGCCGCGATTTTCCGG + Intergenic
993977404 5:94499240-94499262 GAACCTGGGCCTTGTTTCTCAGG - Intronic
997599937 5:135132266-135132288 GTGGCTGAGCCCCTTTTCTCTGG + Intronic
1042875572 8:73437746-73437768 GCACCTGGGCCGCTCTTCTCAGG - Intronic
1049597133 8:143489967-143489989 GTCCCTGAGCCACGGGTCTCTGG + Intronic
1049642275 8:143721084-143721106 GTACCGCAGCCGCGTCTATCAGG + Exonic
1057303539 9:93899874-93899896 CTGCCTGAGCCTCCTTTCTCAGG + Intergenic
1062604700 9:137341486-137341508 GTGCCTGAGCCCCGTTTCCTGGG - Intronic
1189546050 X:42043663-42043685 GTTGCTGAGCCCCATTTCTCAGG - Intergenic
1199782093 X:151070916-151070938 GTACCTGAGCTGGGTATCTATGG - Intergenic