ID: 1160765134

View in Genome Browser
Species Human (GRCh38)
Location 19:804280-804302
Sequence TCGATGAAGGCCTGTTGGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 92}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160765134_1160765145 27 Left 1160765134 19:804280-804302 CCTCCCCAACAGGCCTTCATCGA 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1160765145 19:804330-804352 CATGGTGAACTACTACACCTCGG 0: 1
1: 1
2: 0
3: 4
4: 59
1160765134_1160765140 -9 Left 1160765134 19:804280-804302 CCTCCCCAACAGGCCTTCATCGA 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1160765140 19:804294-804316 CTTCATCGAGATGAACACGGAGG 0: 1
1: 0
2: 1
3: 4
4: 42
1160765134_1160765141 -6 Left 1160765134 19:804280-804302 CCTCCCCAACAGGCCTTCATCGA 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1160765141 19:804297-804319 CATCGAGATGAACACGGAGGAGG 0: 1
1: 0
2: 1
3: 7
4: 72
1160765134_1160765142 9 Left 1160765134 19:804280-804302 CCTCCCCAACAGGCCTTCATCGA 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1160765142 19:804312-804334 GGAGGAGGCTGCCAACACCATGG 0: 2
1: 0
2: 1
3: 32
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160765134 Original CRISPR TCGATGAAGGCCTGTTGGGG AGG (reversed) Exonic