ID: 1160765136

View in Genome Browser
Species Human (GRCh38)
Location 19:804284-804306
Sequence CATCTCGATGAAGGCCTGTT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 55}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160765136_1160765142 5 Left 1160765136 19:804284-804306 CCCAACAGGCCTTCATCGAGATG 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1160765142 19:804312-804334 GGAGGAGGCTGCCAACACCATGG 0: 2
1: 0
2: 1
3: 32
4: 279
1160765136_1160765145 23 Left 1160765136 19:804284-804306 CCCAACAGGCCTTCATCGAGATG 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1160765145 19:804330-804352 CATGGTGAACTACTACACCTCGG 0: 1
1: 1
2: 0
3: 4
4: 59
1160765136_1160765141 -10 Left 1160765136 19:804284-804306 CCCAACAGGCCTTCATCGAGATG 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1160765141 19:804297-804319 CATCGAGATGAACACGGAGGAGG 0: 1
1: 0
2: 1
3: 7
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160765136 Original CRISPR CATCTCGATGAAGGCCTGTT GGG (reversed) Exonic