ID: 1160765137

View in Genome Browser
Species Human (GRCh38)
Location 19:804285-804307
Sequence TCATCTCGATGAAGGCCTGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 58}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160765137_1160765145 22 Left 1160765137 19:804285-804307 CCAACAGGCCTTCATCGAGATGA 0: 1
1: 0
2: 2
3: 8
4: 58
Right 1160765145 19:804330-804352 CATGGTGAACTACTACACCTCGG 0: 1
1: 1
2: 0
3: 4
4: 59
1160765137_1160765142 4 Left 1160765137 19:804285-804307 CCAACAGGCCTTCATCGAGATGA 0: 1
1: 0
2: 2
3: 8
4: 58
Right 1160765142 19:804312-804334 GGAGGAGGCTGCCAACACCATGG 0: 2
1: 0
2: 1
3: 32
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160765137 Original CRISPR TCATCTCGATGAAGGCCTGT TGG (reversed) Exonic
901783184 1:11608143-11608165 TCCTCTCCATGAAGCCCCGTGGG - Intergenic
904969309 1:34406495-34406517 TAATCTAGATGAGGCCCTGTGGG - Intergenic
906875355 1:49532178-49532200 TCATCTCTATGAAGGCAGGCAGG + Intronic
907675779 1:56516594-56516616 TCATCTGCATGAAGGCCTCTGGG + Intronic
918098878 1:181356594-181356616 TCTTCTCCCTGAAGGCCTGCTGG - Intergenic
918269954 1:182888764-182888786 TCATCTTGAGGCAGGCCTGTAGG - Intergenic
918375003 1:183900218-183900240 TCACCTCGATGTAGTCCTGAAGG - Exonic
920826435 1:209427774-209427796 TCAGTTCCATGAAGGGCTGTGGG + Intergenic
923580820 1:235210660-235210682 ACATCTTGATGAAGACCTGTAGG - Intronic
1072337962 10:94416924-94416946 TCATCTGGATGATTGCCTCTAGG + Intronic
1073547634 10:104365155-104365177 TGATCTCCATGAAGGCCAGGGGG + Intronic
1081266211 11:41025496-41025518 TCATTTCTATAAAGGCCTGAAGG + Intronic
1095049945 12:37546285-37546307 TCATCTTCTTGAAGGTCTGTGGG - Intergenic
1101898551 12:108774008-108774030 TCCCCTCCCTGAAGGCCTGTTGG + Intergenic
1108542467 13:51456641-51456663 ACATCTCAGTGAAGGCCTGTAGG - Intergenic
1112795142 13:103048654-103048676 TCAACTAGGTGAAGGCCAGTGGG + Intronic
1114115327 14:19616265-19616287 TCATGTTGATGCATGCCTGTAGG - Intergenic
1122245960 14:100403824-100403846 TCATCTCGATGGAAGTCTGAGGG - Intronic
1122441267 14:101733714-101733736 TCATCTCTAAGGAGGCCTGCTGG + Intergenic
1134631280 16:15757838-15757860 TGAGCTCGATGCAGGGCTGTAGG + Exonic
1140246723 16:73256831-73256853 TCCTCTCCATCAAGTCCTGTTGG + Intergenic
1141949463 16:87331317-87331339 GCATCTCATCGAAGGCCTGTGGG + Exonic
1146579982 17:34028695-34028717 TCATCTCCAGGAACACCTGTGGG - Intronic
1148427534 17:47612461-47612483 TCATCTCGATGCACTCCTGAGGG + Exonic
1151753318 17:76054919-76054941 TCATATCAATGAAGGCATATAGG + Intronic
1155240870 18:23862548-23862570 TCTTCTGGGTGAAGGACTGTGGG + Intronic
1158205611 18:54989622-54989644 TCAACTCAATAAAGGACTGTAGG - Intergenic
1160765137 19:804285-804307 TCATCTCGATGAAGGCCTGTTGG - Exonic
1164742914 19:30590015-30590037 TCATCTGGATGGAGCCCAGTGGG - Intronic
928819320 2:35342079-35342101 TCAGCTGGTTGAAGGCCTGCTGG - Intergenic
944086297 2:195851369-195851391 TCATCTCTGTGAAGGCTTGAAGG - Intronic
1173841483 20:46160292-46160314 TCATCCAGATGAGGGCCTGGAGG - Intergenic
1174482541 20:50841759-50841781 CCATCTTGACGAAGGCCTGAGGG - Exonic
1176148925 20:63579059-63579081 TCATCTCGAAGGAGGCCTCCCGG - Intergenic
957110339 3:75947563-75947585 TGATCTAGATGAAACCCTGTGGG + Intronic
961112485 3:124296812-124296834 TCAGCCAGATGAAGGCCAGTGGG - Intronic
962374532 3:134849371-134849393 TCTTCTCCATGAAGTCCTCTTGG - Intronic
968916399 4:3498753-3498775 TCATCTCGATGAAGGGGTCCTGG + Intronic
971231264 4:24801446-24801468 TGATTTTGATGAAGGCTTGTTGG + Intergenic
980454797 4:133025081-133025103 ACTTCTCGATGAAGGCATTTAGG - Intergenic
981085803 4:140682335-140682357 TAAGCTCGATGAAGGCCAGGAGG + Intronic
991201442 5:63998582-63998604 TCAGAGCGATGTAGGCCTGTTGG + Intergenic
993449808 5:88059706-88059728 TCATCTCAATTCAGGCCTGAGGG - Intergenic
994073217 5:95623654-95623676 TCATCTCAATGATGGCATGAAGG + Intergenic
995610900 5:113909380-113909402 TCATGTGGATGAAGCCTTGTGGG + Intergenic
996911808 5:128665272-128665294 TCATTACCATGAAGGACTGTGGG - Intronic
997702824 5:135916286-135916308 TGAACACGATTAAGGCCTGTTGG + Intergenic
998423243 5:142006311-142006333 TGGTCTCGAGGAAGGCCTGTGGG + Exonic
1002206058 5:177563422-177563444 ACCTCTCCATGAATGCCTGTGGG - Intergenic
1004826246 6:19424678-19424700 TCTTCACCATGAAGGCTTGTTGG - Intergenic
1007599876 6:43075238-43075260 TCATCTCCAGCAGGGCCTGTAGG + Intergenic
1011109707 6:83823509-83823531 TCATTTCAATAAAGGCATGTGGG + Intergenic
1020146727 7:5650094-5650116 TCATCTCTATGAAGTTCTGGTGG + Intronic
1028149111 7:87351661-87351683 TCACCACGTTGAATGCCTGTGGG + Intronic
1033187553 7:139242397-139242419 TCATCTCGATGTAGAGCTTTGGG + Intronic
1036508267 8:9376400-9376422 TGATCTAGATCAAGGGCTGTTGG - Intergenic
1047572013 8:126109435-126109457 TGATCCCTCTGAAGGCCTGTAGG + Intergenic
1047852477 8:128873084-128873106 TCATCTCCATGAGGACCTGTGGG + Intergenic
1049731223 8:144179553-144179575 TCATCTCGCTGGAGGCCAGGAGG - Exonic
1051484999 9:17598599-17598621 TCATCTGGATCAAGGCCTAAAGG - Intronic
1059860372 9:118453478-118453500 TCATCTCAATGAAGGCAAGATGG - Intergenic
1060440275 9:123632421-123632443 TCATCTCTAAGAAGCCCTGAAGG - Intronic
1061194124 9:129098271-129098293 CCATCTGGATGAAGGCATCTGGG + Exonic
1062555516 9:137112014-137112036 TGATCTCGGTGCAGGCCTGCAGG + Exonic
1191615862 X:63168735-63168757 TCATCTCGTTTAAGGCCTGAAGG - Intergenic
1191620436 X:63210188-63210210 TCATCTCGTTTAAGGCCTGAAGG + Intergenic
1195349875 X:103985863-103985885 TCATCTCGAGGATGGCCTGTGGG - Intergenic
1195357568 X:104052976-104052998 TCATCTCGAGGATGGCCTGTGGG + Intergenic
1196006075 X:110838665-110838687 TCATGTAGATGAAGCCTTGTAGG - Intergenic