ID: 1160765137

View in Genome Browser
Species Human (GRCh38)
Location 19:804285-804307
Sequence TCATCTCGATGAAGGCCTGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 58}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160765137_1160765145 22 Left 1160765137 19:804285-804307 CCAACAGGCCTTCATCGAGATGA 0: 1
1: 0
2: 2
3: 8
4: 58
Right 1160765145 19:804330-804352 CATGGTGAACTACTACACCTCGG 0: 1
1: 1
2: 0
3: 4
4: 59
1160765137_1160765142 4 Left 1160765137 19:804285-804307 CCAACAGGCCTTCATCGAGATGA 0: 1
1: 0
2: 2
3: 8
4: 58
Right 1160765142 19:804312-804334 GGAGGAGGCTGCCAACACCATGG 0: 2
1: 0
2: 1
3: 32
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160765137 Original CRISPR TCATCTCGATGAAGGCCTGT TGG (reversed) Exonic