ID: 1160765139

View in Genome Browser
Species Human (GRCh38)
Location 19:804293-804315
Sequence CTCCGTGTTCATCTCGATGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 3, 3: 3, 4: 46}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160765139_1160765142 -4 Left 1160765139 19:804293-804315 CCTTCATCGAGATGAACACGGAG 0: 1
1: 0
2: 3
3: 3
4: 46
Right 1160765142 19:804312-804334 GGAGGAGGCTGCCAACACCATGG 0: 2
1: 0
2: 1
3: 32
4: 279
1160765139_1160765145 14 Left 1160765139 19:804293-804315 CCTTCATCGAGATGAACACGGAG 0: 1
1: 0
2: 3
3: 3
4: 46
Right 1160765145 19:804330-804352 CATGGTGAACTACTACACCTCGG 0: 1
1: 1
2: 0
3: 4
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160765139 Original CRISPR CTCCGTGTTCATCTCGATGA AGG (reversed) Exonic