ID: 1160765139 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:804293-804315 |
| Sequence | CTCCGTGTTCATCTCGATGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 53 | |||
| Summary | {0: 1, 1: 0, 2: 3, 3: 3, 4: 46} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1160765139_1160765142 | -4 | Left | 1160765139 | 19:804293-804315 | CCTTCATCGAGATGAACACGGAG | 0: 1 1: 0 2: 3 3: 3 4: 46 |
||
| Right | 1160765142 | 19:804312-804334 | GGAGGAGGCTGCCAACACCATGG | 0: 2 1: 0 2: 1 3: 32 4: 279 |
||||
| 1160765139_1160765145 | 14 | Left | 1160765139 | 19:804293-804315 | CCTTCATCGAGATGAACACGGAG | 0: 1 1: 0 2: 3 3: 3 4: 46 |
||
| Right | 1160765145 | 19:804330-804352 | CATGGTGAACTACTACACCTCGG | 0: 1 1: 1 2: 0 3: 4 4: 59 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1160765139 | Original CRISPR | CTCCGTGTTCATCTCGATGA AGG (reversed) | Exonic | ||