ID: 1160765142

View in Genome Browser
Species Human (GRCh38)
Location 19:804312-804334
Sequence GGAGGAGGCTGCCAACACCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 2, 1: 0, 2: 1, 3: 32, 4: 279}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160765139_1160765142 -4 Left 1160765139 19:804293-804315 CCTTCATCGAGATGAACACGGAG 0: 1
1: 0
2: 3
3: 3
4: 46
Right 1160765142 19:804312-804334 GGAGGAGGCTGCCAACACCATGG 0: 2
1: 0
2: 1
3: 32
4: 279
1160765131_1160765142 23 Left 1160765131 19:804266-804288 CCCAGCGCTCACTGCCTCCCCAA 0: 1
1: 0
2: 1
3: 23
4: 273
Right 1160765142 19:804312-804334 GGAGGAGGCTGCCAACACCATGG 0: 2
1: 0
2: 1
3: 32
4: 279
1160765135_1160765142 6 Left 1160765135 19:804283-804305 CCCCAACAGGCCTTCATCGAGAT 0: 1
1: 0
2: 0
3: 9
4: 70
Right 1160765142 19:804312-804334 GGAGGAGGCTGCCAACACCATGG 0: 2
1: 0
2: 1
3: 32
4: 279
1160765136_1160765142 5 Left 1160765136 19:804284-804306 CCCAACAGGCCTTCATCGAGATG 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1160765142 19:804312-804334 GGAGGAGGCTGCCAACACCATGG 0: 2
1: 0
2: 1
3: 32
4: 279
1160765134_1160765142 9 Left 1160765134 19:804280-804302 CCTCCCCAACAGGCCTTCATCGA 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1160765142 19:804312-804334 GGAGGAGGCTGCCAACACCATGG 0: 2
1: 0
2: 1
3: 32
4: 279
1160765132_1160765142 22 Left 1160765132 19:804267-804289 CCAGCGCTCACTGCCTCCCCAAC 0: 1
1: 0
2: 2
3: 33
4: 388
Right 1160765142 19:804312-804334 GGAGGAGGCTGCCAACACCATGG 0: 2
1: 0
2: 1
3: 32
4: 279
1160765137_1160765142 4 Left 1160765137 19:804285-804307 CCAACAGGCCTTCATCGAGATGA 0: 1
1: 0
2: 2
3: 8
4: 58
Right 1160765142 19:804312-804334 GGAGGAGGCTGCCAACACCATGG 0: 2
1: 0
2: 1
3: 32
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160765142 Original CRISPR GGAGGAGGCTGCCAACACCA TGG Exonic