ID: 1160765145 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:804330-804352 |
Sequence | CATGGTGAACTACTACACCT CGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 65 | |||
Summary | {0: 1, 1: 1, 2: 0, 3: 4, 4: 59} |
Found 5 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1160765137_1160765145 | 22 | Left | 1160765137 | 19:804285-804307 | CCAACAGGCCTTCATCGAGATGA | 0: 1 1: 0 2: 2 3: 8 4: 58 |
||
Right | 1160765145 | 19:804330-804352 | CATGGTGAACTACTACACCTCGG | 0: 1 1: 1 2: 0 3: 4 4: 59 |
||||
1160765139_1160765145 | 14 | Left | 1160765139 | 19:804293-804315 | CCTTCATCGAGATGAACACGGAG | 0: 1 1: 0 2: 3 3: 3 4: 46 |
||
Right | 1160765145 | 19:804330-804352 | CATGGTGAACTACTACACCTCGG | 0: 1 1: 1 2: 0 3: 4 4: 59 |
||||
1160765136_1160765145 | 23 | Left | 1160765136 | 19:804284-804306 | CCCAACAGGCCTTCATCGAGATG | 0: 1 1: 0 2: 0 3: 2 4: 55 |
||
Right | 1160765145 | 19:804330-804352 | CATGGTGAACTACTACACCTCGG | 0: 1 1: 1 2: 0 3: 4 4: 59 |
||||
1160765135_1160765145 | 24 | Left | 1160765135 | 19:804283-804305 | CCCCAACAGGCCTTCATCGAGAT | 0: 1 1: 0 2: 0 3: 9 4: 70 |
||
Right | 1160765145 | 19:804330-804352 | CATGGTGAACTACTACACCTCGG | 0: 1 1: 1 2: 0 3: 4 4: 59 |
||||
1160765134_1160765145 | 27 | Left | 1160765134 | 19:804280-804302 | CCTCCCCAACAGGCCTTCATCGA | 0: 1 1: 0 2: 0 3: 4 4: 92 |
||
Right | 1160765145 | 19:804330-804352 | CATGGTGAACTACTACACCTCGG | 0: 1 1: 1 2: 0 3: 4 4: 59 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1160765145 | Original CRISPR | CATGGTGAACTACTACACCT CGG | Exonic | ||