ID: 1160765145

View in Genome Browser
Species Human (GRCh38)
Location 19:804330-804352
Sequence CATGGTGAACTACTACACCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 1, 2: 0, 3: 4, 4: 59}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160765137_1160765145 22 Left 1160765137 19:804285-804307 CCAACAGGCCTTCATCGAGATGA 0: 1
1: 0
2: 2
3: 8
4: 58
Right 1160765145 19:804330-804352 CATGGTGAACTACTACACCTCGG 0: 1
1: 1
2: 0
3: 4
4: 59
1160765139_1160765145 14 Left 1160765139 19:804293-804315 CCTTCATCGAGATGAACACGGAG 0: 1
1: 0
2: 3
3: 3
4: 46
Right 1160765145 19:804330-804352 CATGGTGAACTACTACACCTCGG 0: 1
1: 1
2: 0
3: 4
4: 59
1160765136_1160765145 23 Left 1160765136 19:804284-804306 CCCAACAGGCCTTCATCGAGATG 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1160765145 19:804330-804352 CATGGTGAACTACTACACCTCGG 0: 1
1: 1
2: 0
3: 4
4: 59
1160765135_1160765145 24 Left 1160765135 19:804283-804305 CCCCAACAGGCCTTCATCGAGAT 0: 1
1: 0
2: 0
3: 9
4: 70
Right 1160765145 19:804330-804352 CATGGTGAACTACTACACCTCGG 0: 1
1: 1
2: 0
3: 4
4: 59
1160765134_1160765145 27 Left 1160765134 19:804280-804302 CCTCCCCAACAGGCCTTCATCGA 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1160765145 19:804330-804352 CATGGTGAACTACTACACCTCGG 0: 1
1: 1
2: 0
3: 4
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160765145 Original CRISPR CATGGTGAACTACTACACCT CGG Exonic