ID: 1160766097

View in Genome Browser
Species Human (GRCh38)
Location 19:808757-808779
Sequence CATCCCGTGAGTGCTGGGCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 185}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160766087_1160766097 7 Left 1160766087 19:808727-808749 CCCGCCCTCGGCCACGCTGCACC 0: 1
1: 0
2: 2
3: 13
4: 261
Right 1160766097 19:808757-808779 CATCCCGTGAGTGCTGGGCCGGG 0: 1
1: 0
2: 2
3: 24
4: 185
1160766085_1160766097 19 Left 1160766085 19:808715-808737 CCAGAACATATTCCCGCCCTCGG 0: 2
1: 0
2: 0
3: 3
4: 32
Right 1160766097 19:808757-808779 CATCCCGTGAGTGCTGGGCCGGG 0: 1
1: 0
2: 2
3: 24
4: 185
1160766091_1160766097 -4 Left 1160766091 19:808738-808760 CCACGCTGCACCTCTCCAACATC 0: 1
1: 0
2: 2
3: 18
4: 164
Right 1160766097 19:808757-808779 CATCCCGTGAGTGCTGGGCCGGG 0: 1
1: 0
2: 2
3: 24
4: 185
1160766084_1160766097 29 Left 1160766084 19:808705-808727 CCAAGAACTTCCAGAACATATTC 0: 1
1: 0
2: 1
3: 24
4: 250
Right 1160766097 19:808757-808779 CATCCCGTGAGTGCTGGGCCGGG 0: 1
1: 0
2: 2
3: 24
4: 185
1160766089_1160766097 3 Left 1160766089 19:808731-808753 CCCTCGGCCACGCTGCACCTCTC 0: 1
1: 0
2: 2
3: 9
4: 145
Right 1160766097 19:808757-808779 CATCCCGTGAGTGCTGGGCCGGG 0: 1
1: 0
2: 2
3: 24
4: 185
1160766088_1160766097 6 Left 1160766088 19:808728-808750 CCGCCCTCGGCCACGCTGCACCT 0: 1
1: 0
2: 3
3: 14
4: 207
Right 1160766097 19:808757-808779 CATCCCGTGAGTGCTGGGCCGGG 0: 1
1: 0
2: 2
3: 24
4: 185
1160766090_1160766097 2 Left 1160766090 19:808732-808754 CCTCGGCCACGCTGCACCTCTCC 0: 1
1: 0
2: 1
3: 15
4: 245
Right 1160766097 19:808757-808779 CATCCCGTGAGTGCTGGGCCGGG 0: 1
1: 0
2: 2
3: 24
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160766097 Original CRISPR CATCCCGTGAGTGCTGGGCC GGG Exonic
900360797 1:2287923-2287945 CAGCCCTTGAGTGCCAGGCCAGG - Intronic
900373800 1:2344225-2344247 CATCACCTGAGGGCTGGGCGTGG + Intronic
901643508 1:10704862-10704884 CAGCCCGTGAAGGCTGGGCCAGG + Intronic
907242346 1:53087795-53087817 CATCTAGGGAGTGATGGGCCCGG - Exonic
912218706 1:107647410-107647432 CATTCCATAAGTGCTGGGCATGG + Intronic
915543924 1:156585198-156585220 GTTCCGGTGAGGGCTGGGCCGGG + Exonic
915974537 1:160376296-160376318 CATCCCCTGAGAGGTGGCCCTGG + Intergenic
916412547 1:164559885-164559907 CATCCTGCAAGTGCTGGGACAGG - Exonic
917449147 1:175132388-175132410 CATTTCGTGAGTGCTGGCCCTGG - Intronic
919888332 1:201951454-201951476 CATCTCAGGAGTGCTGGGCCAGG - Intergenic
920601967 1:207335763-207335785 CATCCCGTGTGTGATGGGGCTGG + Intronic
921486156 1:215718120-215718142 CATCTTGTTAGTGCTGTGCCTGG - Intronic
922578575 1:226680229-226680251 CATGACGTGACTGCTGGGGCGGG + Intronic
922806950 1:228395109-228395131 CGGCCCCTGCGTGCTGGGCCAGG - Exonic
922814997 1:228442438-228442460 CATCCAGTGAAGGCTGGCCCCGG + Intergenic
922815591 1:228446666-228446688 CATCCCGTGGGGGCGGGGCGGGG + Intergenic
1063176394 10:3554453-3554475 CAGCCCGTGAGTGCTGGAGCCGG + Intergenic
1067879389 10:50030252-50030274 CTTCCCTTGAGTGCTGGGAAAGG - Intergenic
1067892507 10:50149181-50149203 CTTCCCTTGAGTGCTGGGAAAGG + Intergenic
1069960197 10:72074988-72075010 GATGGGGTGAGTGCTGGGCCAGG - Intronic
1070850987 10:79561295-79561317 CATGTGGTGGGTGCTGGGCCAGG + Intergenic
1070856212 10:79609979-79610001 CATGTGGTGGGTGCTGGGCCAGG - Intergenic
1071224295 10:83509795-83509817 CACCTCGTGAGTGCTGGGGGTGG - Intergenic
1075401261 10:122163254-122163276 CATCCCCTTAGTCCTGGGCCGGG + Intronic
1076321909 10:129589327-129589349 CATCACGGGAGTGTGGGGCCTGG + Intronic
1076445467 10:130510965-130510987 CCTCATGTGAGTGCTGGGCCAGG + Intergenic
1076772823 10:132676373-132676395 CACACCGTGAGTTCTGGGCCAGG + Intronic
1078633958 11:13031481-13031503 CATGAGATGAGTGCTGGGCCAGG + Intergenic
1079060460 11:17244363-17244385 CATCCCATGAGTGTAGGGCCTGG + Intronic
1079263619 11:18908706-18908728 CATCAGCAGAGTGCTGGGCCTGG + Intergenic
1079268009 11:18954347-18954369 CATCAGCAGAGTGCTGGGCCTGG + Intergenic
1081613745 11:44578654-44578676 CATCCACTGAGAGCTGGGGCAGG - Intronic
1084095152 11:66906493-66906515 CACCCCGGGAGTTCTAGGCCAGG - Intronic
1084150409 11:67285568-67285590 CCTCCCGGGGGAGCTGGGCCAGG - Exonic
1088420992 11:109646738-109646760 CATTCCCCGAGTGCTGGGACTGG - Intergenic
1088875909 11:113936086-113936108 CCTCCCATGGCTGCTGGGCCGGG - Intronic
1089696279 11:120218244-120218266 CATCCCCTCAGGGCTAGGCCTGG - Intronic
1091642533 12:2248373-2248395 GATCCCGTGGGTCCTTGGCCCGG - Intronic
1092523265 12:9294299-9294321 CAGCCCTTGAGTGCTGGTCGGGG + Intergenic
1094508917 12:31084449-31084471 CAGCCCTTGAGTGCTGGCCGGGG + Intronic
1102111110 12:110366378-110366400 GAACCCCTAAGTGCTGGGCCTGG - Intergenic
1106116684 13:26823756-26823778 GATCCAGTGAGTGGTGGCCCCGG - Intergenic
1106711621 13:32341980-32342002 CCTCCCATGAGGGCTGGGCGTGG + Intronic
1113984682 13:114304157-114304179 CACCCCTTCAGTGCTGGGGCAGG + Intronic
1114037899 14:18646443-18646465 CCTCCCGTGCCGGCTGGGCCTGG + Intergenic
1114120722 14:19668585-19668607 CCTCCCGTGCCGGCTGGGCCTGG - Intergenic
1119206593 14:72799039-72799061 CATCCCATGAATGATGGGGCTGG + Intronic
1119788107 14:77327547-77327569 CAGTCAGTGAGTGCAGGGCCTGG + Exonic
1122787646 14:104171335-104171357 CAGCCTGCGAGGGCTGGGCCAGG + Intronic
1123158974 14:106258798-106258820 CAACCCCTGTGTGCTGGGCTTGG - Intergenic
1123212747 14:106776194-106776216 CAACCCCTGTGTGCTGGGCTTGG - Intergenic
1125324334 15:38521473-38521495 CTACACGTGAGTGCTGAGCCTGG + Intronic
1130145974 15:81273858-81273880 CATCCTGGGAGTGAGGGGCCAGG + Intronic
1130547426 15:84867443-84867465 CATCCCTGAGGTGCTGGGCCTGG + Intronic
1131515431 15:93073442-93073464 CCTCCCAAGGGTGCTGGGCCTGG - Intronic
1132177706 15:99728422-99728444 CAGCCTGTGTGTGCTTGGCCTGG + Exonic
1132701085 16:1222381-1222403 CATCCCCCCAGTGCAGGGCCTGG - Intronic
1132712621 16:1276306-1276328 TTTCCGGTGAGTCCTGGGCCGGG - Intergenic
1133030699 16:3009696-3009718 CATCCAGTGAGCGCTGTGCCCGG - Intergenic
1134393291 16:13839635-13839657 CATCCACTGAGTGCCAGGCCAGG + Intergenic
1137008765 16:35302890-35302912 CATCACCTGAATGCTGGGCCAGG + Intergenic
1137034264 16:35555939-35555961 CATCACCTGAATGCTGGGGCAGG + Intergenic
1138527417 16:57617081-57617103 CATCCCAGGGGTGCTGGGCTAGG + Intronic
1141597907 16:85108398-85108420 CACTCCCTGAGTTCTGGGCCAGG - Intronic
1142259764 16:89037221-89037243 CCTGCAGTGAGTGCTGGGCAGGG + Intergenic
1145879530 17:28343320-28343342 CCTCCTGTGAGTGCAGGTCCTGG + Intronic
1145983777 17:29030644-29030666 CATCCCTTGGGTGCTCAGCCAGG + Intronic
1146244542 17:31268308-31268330 AATCACATGACTGCTGGGCCAGG - Intronic
1146282616 17:31554788-31554810 CATCCAGTGAGTGGTGGGGGAGG - Intergenic
1148347346 17:46912314-46912336 CATCACCTGTGAGCTGGGCCAGG - Intergenic
1148697157 17:49567547-49567569 CCTCCAGAGAGTGCCGGGCCTGG + Intergenic
1151490566 17:74430587-74430609 CAGCCCGTGAGGGCAAGGCCAGG + Intronic
1151916507 17:77122070-77122092 CATCCCCTGAGTGGTGGACTCGG - Intronic
1152285776 17:79411786-79411808 CGTCCCCTGAGTGCTAGCCCAGG - Intronic
1152947182 17:83204170-83204192 CATGCCGTGAATGCAGGGGCAGG + Intergenic
1203163650 17_GL000205v2_random:74583-74605 TATCCCCTAAGTGTTGGGCCCGG + Intergenic
1157424034 18:47569868-47569890 CATCCTGTGAGTGTGGGGCTAGG + Intergenic
1158393811 18:57064301-57064323 CATCCCGTCGTTGCTTGGCCAGG - Intergenic
1160429995 18:78804534-78804556 CACCAAGTGAGTGCTGGGCCTGG - Intergenic
1160726157 19:618688-618710 CAGCCGGTGAGTGGGGGGCCCGG - Exonic
1160766097 19:808757-808779 CATCCCGTGAGTGCTGGGCCGGG + Exonic
1160878901 19:1310779-1310801 CAGCCCTTGAGTGCTCAGCCGGG - Intergenic
1160937685 19:1605011-1605033 GATGCCGCGAGTGCTGGGCTGGG + Intronic
1160983625 19:1827687-1827709 CATCCTGTGAGGACTGGACCTGG + Exonic
1163118128 19:15200346-15200368 CACCCCGGGCGGGCTGGGCCAGG - Intronic
1164040826 19:21491228-21491250 CATCACCTGAGTGCTCAGCCAGG - Exonic
1164041334 19:21495042-21495064 CATCGCCTGGGTGCTGGGTCAGG - Intergenic
1164117929 19:22240082-22240104 CATCACATAAATGCTGGGCCTGG + Intergenic
1164118193 19:22242222-22242244 CATCACATGAGTGCTGGGAAAGG + Intergenic
1164129253 19:22346883-22346905 CATTCCCTGGGTGCTGGACCAGG - Intergenic
1164170240 19:22718596-22718618 CATCCCGTGGGTGCTGGACCAGG + Intergenic
1164200645 19:23015444-23015466 CATCACCTGAGTGCTGTGACGGG + Intergenic
1164201214 19:23020406-23020428 CATCACATGAGTGCTGGGAAAGG + Intergenic
1164257681 19:23543505-23543527 CATCAACTGTGTGCTGGGCCAGG + Intronic
1164282841 19:23784004-23784026 CATCAACTGTGTGCTGGGCCAGG - Intronic
1164302931 19:23977802-23977824 CATCACCTGTGTGATGGGCCTGG + Intergenic
1164303790 19:23985694-23985716 CATCACCTAAGTGCTGAGCCAGG + Intergenic
1164325455 19:24187485-24187507 CATCACCTGTGTTCTGGGCCAGG + Intergenic
1164668591 19:30059954-30059976 CATCCCGGGAGAGCTGGGTCAGG - Intergenic
1164983311 19:32630309-32630331 CAGTCCGTGAGTGCTGGGCGAGG - Intronic
1167097484 19:47382102-47382124 CAGCACGTGTGAGCTGGGCCAGG + Exonic
1167170133 19:47825414-47825436 CCTCCAGTGAGGGCTGGGCGTGG - Intronic
1167211899 19:48138834-48138856 GACCCCGTGTGTGCTGGGTCTGG + Intronic
1167503040 19:49857972-49857994 GATCCTGTGAGTGCTGGGCTGGG + Exonic
1167713443 19:51125870-51125892 TGTCCTGTGAGTGCTGGGCCGGG + Exonic
1167716313 19:51144679-51144701 TGTCCTGTGAGTGCTGAGCCAGG + Exonic
1167722025 19:51185712-51185734 CGTCCTGTGAGTGCTGGGCCGGG + Intergenic
1167725836 19:51212065-51212087 TCTCCTGTGAGTGCTGGGCCAGG + Intergenic
1167764001 19:51468344-51468366 TCTCCTATGAGTGCTGGGCCAGG - Intergenic
1167768414 19:51499421-51499443 TATCCTGTGAGTTCTGGGCCAGG - Exonic
1167772633 19:51530664-51530686 TCTCCTGTGAGTGCTGGGCCAGG - Exonic
929107356 2:38377584-38377606 CACCCCCTTAGCGCTGGGCCAGG + Intergenic
930008443 2:46915942-46915964 AGTCCCGCCAGTGCTGGGCCCGG - Intronic
931225578 2:60326896-60326918 CATCCTGTGTGTTCAGGGCCAGG - Intergenic
932283155 2:70512194-70512216 AATCCAGAGAGGGCTGGGCCAGG - Intronic
937294680 2:120802817-120802839 CATCCACTGTGTGCTGGGCCAGG + Intronic
937929897 2:127195915-127195937 CATCCCCAGGATGCTGGGCCCGG + Intronic
942464018 2:176189149-176189171 CTTCCCGGGCGTGCTGGGGCGGG + Exonic
943872056 2:193012111-193012133 CAGCCTGGGAGGGCTGGGCCAGG - Intergenic
946128595 2:217586480-217586502 CATCCTGTGAGAGCTGAGTCAGG - Intronic
948328927 2:237150132-237150154 CATCCCGGGAGTCCTGTGACTGG + Intergenic
948568949 2:238905283-238905305 CATCCCCCGACTCCTGGGCCAGG + Intronic
1168840488 20:906967-906989 CATCCAGTGTGGTCTGGGCCTGG + Intronic
1171481437 20:25458475-25458497 CCTCCTGCAAGTGCTGGGCCTGG + Exonic
1172426058 20:34856875-34856897 CACCCCCTGCGTGCTGAGCCTGG + Exonic
1173003254 20:39120809-39120831 CATCCTATGAGTGCTGGGATGGG + Intergenic
1174058349 20:47815131-47815153 CATCACGGGACTGATGGGCCAGG - Intergenic
1174451722 20:50624758-50624780 CCTCACGTGAGGGCTGGGGCCGG - Intronic
1175573343 20:60040693-60040715 GCTCCAGTGAGTCCTGGGCCAGG - Intergenic
1176342888 21:5714633-5714655 CATCCAGGGAGTGTTGGACCTGG - Intergenic
1176475142 21:7146784-7146806 CATCCAGGGAGTGTTGGACCTGG - Intergenic
1176501939 21:7609823-7609845 CATCCAGGGAGTGTTGGACCTGG + Intergenic
1176537209 21:8112702-8112724 CATCCAGGGAGTGTTGGACCTGG - Intergenic
1178695691 21:34791850-34791872 CGTCCCCTGGGTGCTGGGGCCGG + Exonic
1178704373 21:34861272-34861294 CATACCCTGCTTGCTGGGCCTGG - Intronic
1179681831 21:43027622-43027644 CAACCTGTGACTGTTGGGCCAGG + Intronic
1180181196 21:46119367-46119389 CATCCTGTGAGGGCTGAGCAGGG + Intronic
1180462026 22:15573485-15573507 CCTCCCGTGCCGGCTGGGCCTGG + Intergenic
1181118547 22:20649939-20649961 CTTCCCTTGAGTGCTGGGAAAGG + Intergenic
1181274156 22:21677926-21677948 CATCGGGGGAGTGCAGGGCCAGG + Intronic
1183184840 22:36285902-36285924 CATCCCGCTCCTGCTGGGCCTGG + Exonic
1184441892 22:44522129-44522151 CATCCAGTGAGTGCTGAGGGTGG - Intergenic
1184767095 22:46577562-46577584 CATCCCGGGGTTGCGGGGCCCGG + Intronic
1203242153 22_KI270733v1_random:29106-29128 CATCCAGGGAGTGTTGGACCTGG - Intergenic
954224946 3:49175320-49175342 AACACCCTGAGTGCTGGGCCAGG - Intronic
954416081 3:50394071-50394093 CATGCCCTAAGTGCTGGGCAGGG + Intronic
954422573 3:50426404-50426426 CTTGCAGTGAGAGCTGGGCCTGG + Intronic
955481414 3:59394157-59394179 CATCCCCTTAGAGCTGGACCTGG + Intergenic
960337637 3:116437518-116437540 CATCCAGTTAGTGCTGGTCAAGG - Intronic
961214459 3:125148643-125148665 CAGCCTGTGAGTGCTGGCCGAGG - Intronic
965802782 3:172511854-172511876 CATCCCTTGATTGCTGTGCTGGG - Intronic
969257412 4:6011660-6011682 CATGGCGTGACTGCGGGGCCTGG - Intergenic
969525966 4:7704279-7704301 CATGACGTGAGTGCGGGGACCGG + Exonic
989578711 5:43012288-43012310 CCTCCCTTGAGTTGTGGGCCTGG - Intergenic
992421522 5:76611129-76611151 CATCCTGGTAGTGCTGGGCATGG - Exonic
992743071 5:79793437-79793459 AATCCCGTCAGTGCTGGGTGAGG + Exonic
995710338 5:115028844-115028866 TATCCAGTGACTTCTGGGCCAGG - Intergenic
997284071 5:132665812-132665834 CCACCCGTGAGTGCTGGGAAGGG - Intergenic
998463369 5:142325182-142325204 TAACCCGTGATTGCTGGGACTGG + Intronic
999185320 5:149703141-149703163 CGTCCCATGAGTGTTGGGCTGGG + Intergenic
999940811 5:156540841-156540863 CATCCCCTGAGTGCTGGCCAGGG + Intronic
1001696073 5:173670997-173671019 CATCCTACGAGAGCTGGGCCGGG - Intergenic
1002055577 5:176596475-176596497 CACCCCCTGAGAGCTGGGGCAGG - Exonic
1002195847 5:177500903-177500925 CATCCACTGTGTGCTGGCCCTGG - Intergenic
1006376953 6:33676964-33676986 CTCCCTGTGAGGGCTGGGCCTGG + Intronic
1006914898 6:37587866-37587888 CATCCCGGGAGTGACTGGCCAGG - Intergenic
1006925743 6:37654352-37654374 CATCCCTTCAGTGCAGGCCCGGG - Exonic
1007151837 6:39701259-39701281 CTTCCCGTGGGGGCTGGACCAGG - Intronic
1007425653 6:41744380-41744402 CCTGCAGTGAGTGCTGGGCTGGG - Exonic
1012981488 6:105834978-105835000 CTTCCAGTTAGTGTTGGGCCAGG - Intergenic
1014894565 6:126886223-126886245 CATCCTGTCAGTGCTGGGAGTGG - Intergenic
1017029009 6:150204692-150204714 CAACCCGTGAGAGCTGGGGCAGG - Intronic
1017722880 6:157256471-157256493 CATCTCTGGAGTTCTGGGCCTGG - Intergenic
1017748698 6:157469953-157469975 CAGCCAGTGAGTGGTGGGCCTGG - Intronic
1017805872 6:157945170-157945192 CATCCCGGGACTGCTGCTCCTGG - Intergenic
1018024234 6:159791105-159791127 CCTCCCGTGAGTTCTGGCACAGG + Exonic
1024269714 7:47633119-47633141 CATGCAGTGACTGCTGAGCCTGG - Intergenic
1024345694 7:48310806-48310828 CGTCCGGAAAGTGCTGGGCCTGG - Intronic
1025161290 7:56663339-56663361 CATCACCTGAATGCTGGGCTGGG - Intergenic
1025615776 7:63114727-63114749 CAGCCCCTCAGTGCTGGGCGCGG + Intergenic
1025749906 7:64284721-64284743 CATCACCTGAATGCTGGACCAGG + Intergenic
1025751572 7:64298372-64298394 CATCACCTGAATTCTGGGCCAGG + Intergenic
1025751698 7:64299534-64299556 CATCACCTGAGTGCTAGGCAAGG + Intergenic
1026087558 7:67275052-67275074 CATACAGTGAGGGCTGGGCACGG + Intergenic
1026726674 7:72875179-72875201 CATACAGTGAGGGCTGGGCATGG - Intergenic
1027117165 7:75490434-75490456 CATACAGTGAGGGCTGGGCACGG + Intergenic
1027274644 7:76545171-76545193 CATACAGTGAGGGCTGGGCACGG - Intergenic
1028626321 7:92881144-92881166 CATCCCCTGGGTGGTGGGCACGG - Intergenic
1029720337 7:102359628-102359650 CATACAGTGAGGGCTGGGCACGG - Intergenic
1035070676 7:156143272-156143294 AATCCCGAGCATGCTGGGCCTGG + Intergenic
1035218507 7:157390095-157390117 CATCCCGTGAGTGCTGGCTGCGG + Intronic
1035382354 7:158447981-158448003 CAGCCCGAGGATGCTGGGCCAGG + Intronic
1035620106 8:1029994-1030016 CCTCCCCTGGGTGCAGGGCCGGG - Intergenic
1036473354 8:9070866-9070888 CAGCCCATGTGTGCAGGGCCGGG + Intronic
1037812753 8:22096616-22096638 GACCCTCTGAGTGCTGGGCCAGG + Intronic
1046031481 8:108787655-108787677 CATCCCGGGAGTTGTAGGCCAGG + Intergenic
1047491900 8:125382097-125382119 GAGCCAGTGAGTGATGGGCCAGG + Intergenic
1048541234 8:135343959-135343981 AGTCCTGTGAGGGCTGGGCCAGG - Intergenic
1049068321 8:140337273-140337295 CACCTCTTGTGTGCTGGGCCTGG - Intronic
1049716438 8:144095223-144095245 CCTCAGGTGAGCGCTGGGCCGGG + Exonic
1053368520 9:37541425-37541447 CGTACCCTGAGTGTTGGGCCAGG - Exonic
1053896071 9:42742602-42742624 TACCCTGTTAGTGCTGGGCCTGG + Intergenic
1059230916 9:112720811-112720833 CACCCAGTAAGTGCAGGGCCAGG - Intergenic
1061320104 9:129823435-129823457 CATCCCAGGAGGGCCGGGCCTGG - Intronic
1062117721 9:134818264-134818286 CCTCCCGTGTGCTCTGGGCCAGG - Intronic
1062585083 9:137245572-137245594 CAGCCTGTGAGTGCCGGGACAGG + Intronic
1062726341 9:138076147-138076169 CATCCTGGGAGCCCTGGGCCAGG + Intronic
1203458481 Un_GL000220v1:12183-12205 CATCCAGGGAGTGTTGGACCTGG - Intergenic
1187670059 X:21658240-21658262 CGTCCCGGGAGTGCAGGGCGAGG + Exonic
1194956745 X:100189895-100189917 AATTCCTTGAGGGCTGGGCCTGG - Intergenic
1200148409 X:153939513-153939535 CAGCCAGTGAGGGCTGGCCCAGG - Intronic
1202080517 Y:21079366-21079388 CATCACCTGAGAGCTTGGCCAGG - Intergenic