ID: 1160766723

View in Genome Browser
Species Human (GRCh38)
Location 19:812112-812134
Sequence CAGGCTCAGTATTGTGACCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 89}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160766723 Original CRISPR CAGGCTCAGTATTGTGACCG CGG Exonic
900589670 1:3454079-3454101 CAGGCTCAGCCTTGTGCACGAGG + Intergenic
901015188 1:6225280-6225302 CAGGCTCATCAGGGTGACCGTGG + Intronic
903019877 1:20386493-20386515 TAGGCCCAGTGTTGTGACTGGGG - Intergenic
904466383 1:30710526-30710548 CAGGCTCACTATGGTGAAAGGGG - Intergenic
920247631 1:204600354-204600376 CAGTCTCAGCTGTGTGACCGTGG + Intergenic
922728093 1:227934995-227935017 CAGGCTCTGTATAGTGAACTGGG - Intronic
922728099 1:227935057-227935079 CAGGCTCTGTATGGTGAACTGGG - Intronic
922728106 1:227935120-227935142 CAGGCTCTGTATGGTGAACTGGG - Intronic
1070757012 10:78999584-78999606 CAGGCTCACAATTCTGACCAGGG + Intergenic
1074561198 10:114536736-114536758 CAGGGTCAGTATTGAGACACTGG - Intronic
1076819796 10:132932540-132932562 CAGGCTCTGTATGGGGAGCGTGG - Intronic
1084290913 11:68166452-68166474 CAGACTCAGAATTGTGATAGAGG - Intronic
1087439191 11:98161361-98161383 CAGGCTCAGGCTTGTGAGCAGGG - Intergenic
1090285788 11:125497622-125497644 CATGCCCAGTTTTGTGACCTTGG + Exonic
1093144178 12:15544591-15544613 GAGCCTCAGAATTGTGACTGAGG + Intronic
1097609191 12:61797227-61797249 CATGCTCAGCATTGTTACTGTGG - Intronic
1102455818 12:113070312-113070334 CAGGCTGAGGCCTGTGACCGGGG - Intronic
1105800262 13:23896866-23896888 CAGGCAGACCATTGTGACCGGGG + Exonic
1105848752 13:24316102-24316124 CAGGCAGACCATTGTGACCGGGG - Exonic
1106558900 13:30832532-30832554 CAGCCTCAGTGGTGTGACCTTGG + Intergenic
1113848384 13:113404789-113404811 CAGGTTCAGGAATGGGACCGGGG - Intergenic
1120436498 14:84489161-84489183 CAGGCTCATTACTGTGACCAAGG + Intergenic
1125428098 15:39569882-39569904 CAGGCTGAGGATTGTTACAGGGG - Intergenic
1129740318 15:77986737-77986759 CAGGCTCAGGCATGTGCCCGAGG - Intronic
1129845434 15:78765860-78765882 CAGGCTCAGGCATGTGCCCGAGG + Exonic
1130256414 15:82327999-82328021 CAGGCTCAGGCGTGTGCCCGAGG - Intergenic
1130598538 15:85261989-85262011 CAGGCTCAGGCGTGTGCCCGAGG + Intergenic
1135787310 16:25361540-25361562 CAGACTCAGGATTGAGACCCAGG + Intergenic
1137984281 16:53094474-53094496 CAGGTTCAGAATTGTCACCTGGG - Intronic
1142518904 17:491565-491587 CACGCTCAGCAGGGTGACCGCGG + Intergenic
1144457971 17:15434342-15434364 CAGGCTCAGTCATGTTGCCGAGG + Intergenic
1144946053 17:18970105-18970127 CAGGCTCTGTATTCAGACCGAGG - Exonic
1147304865 17:39556320-39556342 CAGGGTCAGGGTGGTGACCGAGG - Intronic
1156910106 18:42401812-42401834 CATGCTGAGTATTTTGACTGTGG - Intergenic
1160766723 19:812112-812134 CAGGCTCAGTATTGTGACCGCGG + Exonic
1163931422 19:20396832-20396854 CAGTTTCACTATTGTGACCCAGG - Intergenic
1165121145 19:33559641-33559663 CAGTCTCACTATTGTCACCCAGG + Intergenic
928315296 2:30239924-30239946 CAGACTCACTGTTGTGACCAGGG - Intronic
929846674 2:45537454-45537476 CAGGCACAGTATTGTGTGCTGGG - Intronic
935712623 2:105912773-105912795 CAGGCTCAGACCTGTGACCTAGG - Intergenic
941695574 2:168547734-168547756 CAGGCTGAGAATGGTGACCGGGG - Intronic
942231888 2:173867848-173867870 CAGGCTCAGTATTTGGAAGGGGG - Intergenic
1172123733 20:32613159-32613181 CAGGCTGAGTGTTGAGACCCAGG - Intergenic
1173821904 20:46025049-46025071 CAGGCTCTGTGGTGTGACCTTGG + Intronic
1179897004 21:44368815-44368837 CAGGCTGAGTGTTGGGAGCGAGG + Intronic
1180160707 21:45997648-45997670 CAGGCTTAGCATGGTGACCTTGG - Intronic
1181424125 22:22822162-22822184 CAGGCTCAGGACTGTGGCCCTGG + Intronic
1183218677 22:36497785-36497807 GAGGCTCACTAATGTGCCCGTGG + Intronic
1183539895 22:38423810-38423832 CAGGGTCAGGATTGAGACCCTGG + Intergenic
950756091 3:15173896-15173918 CTGGCTCAGTATGGTGACCAAGG - Intergenic
951667515 3:25143631-25143653 CAGGTTCAGTGTTATGACAGAGG - Intergenic
953116016 3:39993215-39993237 CAGGCTCATTATTGTGGGAGTGG - Intronic
969528329 4:7715456-7715478 CAGGCTCTGTGCTGTGAGCGTGG - Intronic
971358445 4:25914960-25914982 CAGGCTGAGAATGGTGACTGGGG + Intronic
975822327 4:78284625-78284647 GAGGCTCAGTATTGTCAAGGAGG + Intronic
978441432 4:108738232-108738254 CAGGCGCAGTATTGTTGCCAGGG + Intergenic
998777513 5:145619035-145619057 CAGGCTCAGTGCTGTTAGCGGGG - Intronic
998988528 5:147789290-147789312 CAGGATCAGGAGTGTGATCGAGG - Intergenic
1003039298 6:2672113-2672135 CATTCTCAGTGTTGTGACCTCGG - Intronic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006842327 6:37037041-37037063 CAGTCTCACTATTGTCACCCAGG - Intergenic
1019534797 7:1523340-1523362 CAGGCTCAGTCCTGTGCCCTTGG - Intergenic
1020625493 7:10573682-10573704 CAGGCTCAGGATTGAGGCTGTGG - Intergenic
1023825104 7:44003738-44003760 AAGTCTCAGGATTGTGGCCGCGG - Intronic
1023865668 7:44237092-44237114 CAGGCTCTGCATTGGAACCGGGG + Intronic
1026088653 7:67282523-67282545 AAGTCTCAGGATTGTGGCCGCGG - Intergenic
1026466009 7:70655390-70655412 GAGGCTCAGTGTTGTCACAGAGG + Intronic
1026725596 7:72867830-72867852 AAGTCTCAGGATTGTGGCCGCGG + Intergenic
1026747680 7:73025694-73025716 AAGTCTCAGGATTGTGGCCGCGG + Intergenic
1026751330 7:73053833-73053855 AAGTCTCAGGATTGTGGCCGCGG + Intergenic
1026754979 7:73081947-73081969 AAGTCTCAGGATTGTGGCCGCGG + Intergenic
1026758631 7:73109981-73110003 AAGTCTCAGGATTGTGGCCGCGG + Intergenic
1027088774 7:75283504-75283526 AAGTCTCAGGATTGTGGCCGCGG - Intergenic
1027092417 7:75311432-75311454 AAGTCTCAGGATTGTGGCCGCGG - Intergenic
1027096060 7:75339399-75339421 AAGTCTCAGGATTGTGGCCGCGG - Intergenic
1027118249 7:75497823-75497845 AAGTCTCAGGATTGTGGCCGCGG - Intergenic
1027273553 7:76537645-76537667 AAGTCTCAGGATTGTGGCCGCGG + Intergenic
1027528298 7:79299138-79299160 CATGCTCAGAATTGTGAGCATGG + Intronic
1029397060 7:100315670-100315692 AAGTCTCAGGATTGTGGCCGCGG - Intronic
1029719246 7:102352217-102352239 AAGTCTCAGGATTGTGGCCGCGG + Intergenic
1029753369 7:102557049-102557071 AAGTCTCAGGATTGTGGCCGCGG - Intronic
1029771320 7:102656133-102656155 AAGTCTCAGGATTGTGGCCGCGG - Intronic
1031103144 7:117507017-117507039 CTGGCTCAATTTTGTGACCATGG + Intronic
1032363931 7:131281964-131281986 CAGGCTCAGAAATGTGGCAGTGG - Intronic
1035284865 7:157799613-157799635 CAGGCCCAGTGTTCTGAGCGTGG + Intronic
1044999788 8:97869354-97869376 CAGGCTCGGTATTCTGTCGGTGG - Intronic
1046637326 8:116684653-116684675 CAGACTCAGAATTATGACCAGGG + Intronic
1050876929 9:10651004-10651026 CAGACTCAGTAATGTGGCCAAGG + Intergenic
1051137083 9:13934636-13934658 CATGCTCTGTAGTGTGACCTGGG + Intergenic
1059948332 9:119436062-119436084 CTGGCTCAGTATCTGGACCGGGG + Intergenic
1192195947 X:69028254-69028276 GAGGCTCAGTCTTGTGAGGGAGG - Intergenic
1192502018 X:71660670-71660692 CAGCCTCAGTATTGTGTGGGAGG + Intergenic
1193573533 X:83173844-83173866 CATGCAAAGTATTGTCACCGAGG + Intergenic
1195310014 X:103623615-103623637 AAGACTCAGTATTGTGAAAGTGG + Intronic