ID: 1160767515

View in Genome Browser
Species Human (GRCh38)
Location 19:815035-815057
Sequence CACGTCCGTCACCAGGGCTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160767511_1160767515 -7 Left 1160767511 19:815019-815041 CCGTGGCCAGCTGGATCACGTCC 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1160767515 19:815035-815057 CACGTCCGTCACCAGGGCTGTGG 0: 1
1: 0
2: 1
3: 8
4: 106
1160767510_1160767515 -6 Left 1160767510 19:815018-815040 CCCGTGGCCAGCTGGATCACGTC 0: 1
1: 0
2: 0
3: 12
4: 91
Right 1160767515 19:815035-815057 CACGTCCGTCACCAGGGCTGTGG 0: 1
1: 0
2: 1
3: 8
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160767515 Original CRISPR CACGTCCGTCACCAGGGCTG TGG Exonic
900393560 1:2444037-2444059 CCCGACCCGCACCAGGGCTGCGG - Intronic
901513766 1:9731566-9731588 CACGTCCTGCTCCATGGCTGCGG + Intronic
901835883 1:11923788-11923810 CAGATCAGTCACCAGTGCTGAGG + Intronic
904041692 1:27589084-27589106 CACCTCTGGCACCAGGCCTGTGG - Intronic
905675516 1:39822010-39822032 CACAGCCGTCACCCGAGCTGAGG - Intergenic
905819699 1:40979915-40979937 GACGTCCGTCACCGCGGCGGCGG - Intronic
911804835 1:102193109-102193131 CACTCCCGTCACCCAGGCTGGGG + Intergenic
918082454 1:181218070-181218092 CACCTCAGTCACCAGGGAGGGGG - Intergenic
924743569 1:246812486-246812508 CTCGTCCCTCACCTGGGCTATGG + Intergenic
1062930146 10:1347518-1347540 CACCACCTTCTCCAGGGCTGTGG + Intronic
1063171392 10:3513088-3513110 CACCTCCCACACCATGGCTGAGG + Intergenic
1068352609 10:55868826-55868848 GACAGCTGTCACCAGGGCTGCGG + Intergenic
1069986380 10:72286983-72287005 CACCTCTGTCACCCAGGCTGGGG - Intergenic
1070846899 10:79530602-79530624 TCCGTCCGTCACCCAGGCTGGGG + Intergenic
1070929928 10:80253848-80253870 AACCTCCGTCTCCAGGGCTCAGG + Intergenic
1075407726 10:122205678-122205700 CACTTCCTTCTGCAGGGCTGGGG - Intronic
1076570852 10:131432040-131432062 CACGGCCGTGACCAGGGCTGGGG - Intergenic
1077210961 11:1370766-1370788 GACGGCCGTGGCCAGGGCTGGGG + Intergenic
1080668545 11:34356815-34356837 CCCCTCCGCCATCAGGGCTGTGG + Exonic
1083998459 11:66283677-66283699 CCCCTCCCTCCCCAGGGCTGAGG - Exonic
1085821170 11:79795288-79795310 CAAGTCAATCCCCAGGGCTGGGG + Intergenic
1087114682 11:94512599-94512621 CTCCTCCGCCAGCAGGGCTGGGG + Intergenic
1092069365 12:5620353-5620375 CAAGTCCCTTCCCAGGGCTGTGG - Intronic
1100698723 12:97123508-97123530 TAGGTCCCACACCAGGGCTGTGG + Intergenic
1102476995 12:113195232-113195254 CACATCACTCACCAGGGCAGCGG - Intergenic
1108569046 13:51731135-51731157 CAGGTCCATCACCAGGCCTGCGG - Intronic
1113808288 13:113122600-113122622 CTCATCAGTCACCAGGGCCGCGG - Intergenic
1115644209 14:35356111-35356133 CAGGTCCAGAACCAGGGCTGGGG + Intergenic
1122353618 14:101111241-101111263 CACCTCTGTCACCAGGTCTGTGG + Intergenic
1129033732 15:72637371-72637393 CAAGTCCCACAGCAGGGCTGGGG - Intergenic
1129216149 15:74099845-74099867 CAAGTCCCACAGCAGGGCTGGGG + Intergenic
1141570661 16:84931737-84931759 CAGGTCCGTGGCCAGGGCTGTGG - Intergenic
1141663574 16:85454309-85454331 CACTGCCACCACCAGGGCTGAGG - Intergenic
1142044154 16:87914490-87914512 CCCGTCTGTCTCCAAGGCTGAGG + Intronic
1142686535 17:1580354-1580376 CACGTCTGTCAGCAGGGCCCTGG - Intronic
1143020962 17:3917025-3917047 CACATCCGTCACCAGTGCCATGG + Intergenic
1143264901 17:5628987-5629009 CATGTCAGAGACCAGGGCTGCGG - Intergenic
1150218993 17:63485230-63485252 CTCATCAGTCACCAGGTCTGTGG - Exonic
1151358230 17:73572785-73572807 CACATCAGTCATGAGGGCTGAGG - Intronic
1152820600 17:82435870-82435892 CAGGTCGGCCAACAGGGCTGGGG + Exonic
1155493247 18:26419953-26419975 CACGTCCATCCCCACTGCTGGGG + Intergenic
1158299633 18:56036882-56036904 CAACTCAGCCACCAGGGCTGTGG - Intergenic
1160680504 19:409849-409871 CCCCTGCATCACCAGGGCTGGGG - Intergenic
1160767515 19:815035-815057 CACGTCCGTCACCAGGGCTGTGG + Exonic
1165443537 19:35844307-35844329 CACTTCCCTCACCTGGACTGAGG + Exonic
1166771771 19:45287662-45287684 CCCGTGAGTGACCAGGGCTGGGG + Exonic
1168247936 19:55123535-55123557 CGAGTCCGTGACCAGCGCTGGGG - Intergenic
1168413837 19:56156683-56156705 CAAGACCGTAACAAGGGCTGTGG + Intronic
926132932 2:10316491-10316513 CATGGCCCTCACAAGGGCTGAGG - Intronic
927456208 2:23251313-23251335 CACGACCGTCACCACTGCTCAGG + Intergenic
927721268 2:25384125-25384147 CACTTTCCTGACCAGGGCTGGGG + Intronic
927781834 2:25945732-25945754 CTCGTCTGTCACCCAGGCTGCGG - Intronic
933458889 2:82553483-82553505 CAGGTCCATGACCAGGGCTTCGG - Intergenic
934661697 2:96146489-96146511 CACATCCGGCAGCAGGGCTGGGG - Intergenic
935626720 2:105177758-105177780 CATGTCTGGCACCTGGGCTGGGG - Intergenic
937528324 2:122798001-122798023 CATGCCTGTCACCAGGGATGAGG - Intergenic
1169772873 20:9220603-9220625 CTCGTCTGTCACCCAGGCTGGGG - Intronic
1171202420 20:23252628-23252650 TACGTCCGTCTCCAGGGCTCAGG - Intergenic
1172771668 20:37385826-37385848 CGCGTCCGTCCCCGGGGCTTTGG - Intronic
1175993175 20:62799646-62799668 CTCTGCCGCCACCAGGGCTGAGG - Exonic
1176217337 20:63954459-63954481 GAGGTCTGTCCCCAGGGCTGGGG - Intronic
1178369486 21:32015696-32015718 CTCGTCACTCACAAGGGCTGTGG - Intronic
1178501590 21:33130149-33130171 CATGTAAGTCACCAGGACTGGGG - Intergenic
1179503412 21:41823956-41823978 CACCTCTGTGACCAGGGCTGGGG + Intronic
1180185517 21:46137305-46137327 CACGCCCATCTCCAGGGCTTTGG + Exonic
1182335551 22:29581117-29581139 CGCCTCCGCCACCAGGGCTTGGG - Exonic
1184651104 22:45919854-45919876 CAAGGCAGTCCCCAGGGCTGTGG + Intergenic
1184679373 22:46061930-46061952 CGAGTCCGGCACCAGGCCTGAGG - Intronic
1185366613 22:50439752-50439774 CACGTCCCTCACCACTCCTGGGG - Exonic
950071253 3:10154745-10154767 CACATCCGTAACAAGGGCTATGG - Intergenic
955689762 3:61579356-61579378 CATCTCCTTCACCAGGGGTGAGG + Intronic
963213903 3:142724112-142724134 CACGTTGGGCTCCAGGGCTGTGG - Exonic
968753705 4:2403550-2403572 CACTCCGCTCACCAGGGCTGGGG + Intronic
969293908 4:6257943-6257965 CAGGACCGTGACCAGGCCTGTGG + Intergenic
980998950 4:139809559-139809581 CACGTCAGTCACGGGGCCTGGGG + Intronic
986050939 5:4089720-4089742 TCCCTCTGTCACCAGGGCTGGGG + Intergenic
992960564 5:81953972-81953994 CGAGTCCGTGACCAGCGCTGGGG - Intergenic
999232549 5:150070143-150070165 CACCTCCCTCACCTGGGCTCAGG - Intronic
999281283 5:150367868-150367890 CAAGTCCGCCCCCAGGACTGAGG - Exonic
1005763068 6:28985652-28985674 CAAGTCCCTCGCCAGGGCGGGGG + Intergenic
1006119055 6:31792966-31792988 TACGTGAGTCACCAGGCCTGGGG - Exonic
1006638976 6:35479350-35479372 CATGTGCAGCACCAGGGCTGTGG + Intronic
1007128440 6:39447343-39447365 CACCCCCTTCACCTGGGCTGTGG + Intronic
1007711071 6:43824665-43824687 CACGTCCCTCTCCTGGGCTGGGG - Intergenic
1007773399 6:44209043-44209065 AACCTCCGTCTCCAGGGCTCAGG + Intergenic
1007936868 6:45740393-45740415 CAAGATCTTCACCAGGGCTGAGG - Intergenic
1016791480 6:148070928-148070950 CACCTTCGTCTCCAGGGCTCTGG + Intergenic
1017725675 6:157274733-157274755 CCCGTCCGGGACCGGGGCTGCGG - Intergenic
1018450263 6:163901151-163901173 CAGGCCCCTCACCAGGCCTGTGG + Intergenic
1019165774 6:170096746-170096768 CGCCTCCTTCAGCAGGGCTGGGG + Intergenic
1019310811 7:359773-359795 CACCTCCTGCACCAGGGCCGTGG + Intergenic
1025940904 7:66075748-66075770 CGCGGCCGTCGCCAGGGGTGGGG + Intergenic
1029506734 7:100967561-100967583 CACGTCCTTCACCTGGTCTCTGG + Exonic
1032712060 7:134469158-134469180 CACGACCATTTCCAGGGCTGAGG - Intergenic
1035298426 7:157880574-157880596 CACGTCCTTCTCCAGCTCTGAGG + Intronic
1035967339 8:4207829-4207851 CACTGACATCACCAGGGCTGAGG - Intronic
1036144981 8:6246472-6246494 CACGTCAGGCATCAGGGCAGAGG - Intergenic
1036558794 8:9884143-9884165 CTCGGCCGTCACGGGGGCTGTGG + Intergenic
1043666661 8:82823032-82823054 CACGTCCGTCTTCAAGGGTGAGG + Intergenic
1045173762 8:99698052-99698074 CACGGCCCTCGCCAGGGCAGTGG - Intronic
1048970636 8:139643335-139643357 AACGTCCTTCACCCGGACTGGGG + Intronic
1049746446 8:144265221-144265243 CACGTCAGACCCCAGGGCTGGGG - Intronic
1050894767 9:10872752-10872774 CATGTAAGTCACCAGGGCTTGGG + Intergenic
1052622805 9:30935758-30935780 CATGTCCTTCTCCAGGGCTATGG - Intergenic
1053175241 9:35917741-35917763 CAGGCCCCACACCAGGGCTGTGG - Intergenic
1059317281 9:113436887-113436909 CACGCCCACCACCAGGGCTTTGG - Intergenic
1059487649 9:114639165-114639187 CACTCCCGTCACCCAGGCTGGGG + Intronic
1061740942 9:132705562-132705584 CACATCAGTTGCCAGGGCTGTGG - Intergenic
1062651812 9:137581644-137581666 TCCGTCCGTCTGCAGGGCTGTGG - Intergenic
1062696079 9:137877284-137877306 CAGGTCCCGCACCCGGGCTGGGG + Intergenic
1186492320 X:9983661-9983683 CACGTGCGTGGCCGGGGCTGTGG - Intergenic
1190596775 X:52059797-52059819 CTCGTCCATCGCCAGGCCTGGGG + Intergenic
1190612049 X:52194276-52194298 CTCGTCCATCGCCAGGCCTGGGG - Intergenic
1190929507 X:54935474-54935496 CTTGTCCATCACCAGGCCTGAGG - Intronic
1195280527 X:103328489-103328511 CAGGTCTGGCACCAGGGATGGGG - Intergenic
1201477089 Y:14394347-14394369 CAGGTCAGTCACCAGAGGTGAGG - Intergenic