ID: 1160767603

View in Genome Browser
Species Human (GRCh38)
Location 19:815351-815373
Sequence AGGCCTCGGTGCCCACAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 173}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160767588_1160767603 17 Left 1160767588 19:815311-815333 CCCTCGGCCACCATGATCTGCCA 0: 1
1: 0
2: 1
3: 11
4: 242
Right 1160767603 19:815351-815373 AGGCCTCGGTGCCCACAGGGAGG 0: 1
1: 0
2: 0
3: 20
4: 173
1160767594_1160767603 7 Left 1160767594 19:815321-815343 CCATGATCTGCCAACAGGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 186
Right 1160767603 19:815351-815373 AGGCCTCGGTGCCCACAGGGAGG 0: 1
1: 0
2: 0
3: 20
4: 173
1160767592_1160767603 10 Left 1160767592 19:815318-815340 CCACCATGATCTGCCAACAGGGA 0: 1
1: 0
2: 1
3: 17
4: 169
Right 1160767603 19:815351-815373 AGGCCTCGGTGCCCACAGGGAGG 0: 1
1: 0
2: 0
3: 20
4: 173
1160767589_1160767603 16 Left 1160767589 19:815312-815334 CCTCGGCCACCATGATCTGCCAA 0: 1
1: 0
2: 1
3: 8
4: 138
Right 1160767603 19:815351-815373 AGGCCTCGGTGCCCACAGGGAGG 0: 1
1: 0
2: 0
3: 20
4: 173
1160767598_1160767603 -3 Left 1160767598 19:815331-815353 CCAACAGGGAGGGGGCGCTCAGG 0: 2
1: 0
2: 4
3: 19
4: 196
Right 1160767603 19:815351-815373 AGGCCTCGGTGCCCACAGGGAGG 0: 1
1: 0
2: 0
3: 20
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160767603 Original CRISPR AGGCCTCGGTGCCCACAGGG AGG Intronic
900264551 1:1750647-1750669 AGGCGCAGGTGTCCACAGGGTGG + Intergenic
900396425 1:2454962-2454984 AGGCCTGGCTGCCCCCAGGCAGG - Intronic
900531346 1:3155014-3155036 AGGCCTCAGGGCCCACAGGCAGG - Intronic
900543039 1:3213547-3213569 AGGTGTCTGTGCCCCCAGGGAGG - Intronic
900661477 1:3786627-3786649 AGGCCTCAGTCCCCTCCGGGAGG - Intronic
901417733 1:9129094-9129116 GCGCCTCGGTGCCCAGACGGCGG - Exonic
902136349 1:14309486-14309508 GGGCCTTGGAGGCCACAGGGAGG + Intergenic
902384080 1:16066485-16066507 AGGCCTTGGAGCCCAGAGAGGGG - Intronic
902510661 1:16965394-16965416 AGGCCTCTCTGGCCACAGGCTGG - Intronic
902651904 1:17842833-17842855 ATGCCTCCTTGCCCAGAGGGGGG + Intergenic
903384957 1:22920224-22920246 AGGCCACAGTGCCCACTGGCTGG + Intergenic
903561777 1:24233503-24233525 AGGCCTCTTTGGCCACTGGGTGG - Intergenic
903609941 1:24603519-24603541 AGGCATCAGTGCAAACAGGGTGG - Intronic
904190204 1:28737335-28737357 GGGCCTCGGAGCCCACGGGCCGG + Intronic
904279626 1:29409654-29409676 AGGCCTTGGGGCCCACTGGTTGG + Intergenic
904977964 1:34472901-34472923 AAGCCACAGGGCCCACAGGGCGG - Intergenic
918290566 1:183103551-183103573 AGGCCACGTTGCCCCCAGTGAGG - Exonic
921739659 1:218669233-218669255 AGGCCTCAGTGCCCACCACGAGG - Intergenic
922352368 1:224744668-224744690 AGACCTCAGTGCCCACACGTCGG + Intergenic
922619833 1:226982795-226982817 TGGCCTCGGCCCCCACTGGGTGG + Intronic
923745214 1:236693658-236693680 AGGCCTTGGAGCACACAGGGAGG - Intronic
924583366 1:245340922-245340944 TGGCCTCAGTGCCCAAAGTGGGG + Intronic
924615160 1:245606331-245606353 CGGCCCAGGTGCCCACCGGGAGG + Intronic
1069372588 10:67763684-67763706 AGGCCTCAGTGCCGTCAGGTGGG + Intergenic
1069951034 10:72018212-72018234 CTGCCTCGGTGCACACAGTGGGG + Intergenic
1072569220 10:96643791-96643813 AGGGCCCTGGGCCCACAGGGAGG - Intronic
1074159992 10:110829381-110829403 AGGCCCAGGTGCCCGGAGGGAGG - Intronic
1074896898 10:117784978-117785000 AGGCCTGGGTGCTCAAGGGGAGG - Intergenic
1076366197 10:129922371-129922393 AGGCCCCAGTGCCCACTGTGTGG + Intronic
1076872372 10:133200305-133200327 AGGCCACAGTCTCCACAGGGCGG - Intronic
1077098429 11:809973-809995 CGACCTCGGTGGCGACAGGGAGG - Exonic
1077201320 11:1309079-1309101 AGGGCCCGGTGCCCAGATGGAGG - Intronic
1077220092 11:1411912-1411934 AGGCCACGTTCCCCACAGGATGG - Intronic
1077292503 11:1804353-1804375 AAGGCTCTGTGCTCACAGGGCGG + Intergenic
1077363756 11:2153040-2153062 AGGCCTCAGTGCCAGCAAGGCGG + Intronic
1078548900 11:12267109-12267131 AGGCCTGGGTGTCCGAAGGGAGG - Intergenic
1079492475 11:21004539-21004561 ATGCCTTGGTCTCCACAGGGAGG + Intronic
1080749357 11:35138652-35138674 GTGCCTCCGTGCCCACAGTGGGG - Intergenic
1082897932 11:58212927-58212949 AGGCCTTGGTAACCACAGGCCGG + Intergenic
1083696670 11:64448112-64448134 AGGGCTCCGTTCCCACAGCGCGG + Intergenic
1084374118 11:68764348-68764370 AGGCCCTGGTGGCCCCAGGGTGG + Intronic
1084420695 11:69059133-69059155 AGGACTCGGGCCCCTCAGGGAGG - Intronic
1089634909 11:119805821-119805843 AGGCCTCGGGGCCCACTGCCTGG + Intergenic
1090057748 11:123438192-123438214 ATGCCTCGGTCCCCCCAGGCAGG + Intergenic
1101883644 12:108642623-108642645 TGGACTCGGTTCCCACAGGAGGG + Intergenic
1101904494 12:108814685-108814707 TGGGGTCGGTGCCCACAGGTGGG + Intronic
1104013694 12:124949072-124949094 AGGCCTCGGTGGGCAGGGGGTGG - Intronic
1112792037 13:103013927-103013949 AGGCCTCAGTTCCCACACAGAGG + Intergenic
1113506114 13:110817128-110817150 AGGTCAGGGTGCCCACAGGTAGG - Intergenic
1118600809 14:67470459-67470481 AGGTCTGGGTGGCCTCAGGGTGG + Exonic
1118854823 14:69612318-69612340 ATGCCGCGGTGCGCACAGGCGGG - Intronic
1120960618 14:90121344-90121366 AAGCCACGGTGCTTACAGGGAGG - Intronic
1121019173 14:90568613-90568635 AGTCCTCGGTGAGGACAGGGTGG + Intronic
1121258494 14:92549315-92549337 AGGCCTCGGTTCCCACCGTGAGG + Intronic
1121273367 14:92652096-92652118 AGGCCTGGGCCCCCTCAGGGAGG + Exonic
1122745461 14:103894825-103894847 ATGCCAGGGTGCCCCCAGGGTGG + Intergenic
1123173879 14:106399596-106399618 AGGCCTCTGTGCGCACCGGGAGG - Intergenic
1123182132 14:106480870-106480892 AGGCCTCTGTGCGCACCGGGAGG - Intergenic
1202944773 14_KI270726v1_random:15860-15882 AGGCCTCTGTGCGCACCGGGAGG + Intergenic
1124341002 15:28889052-28889074 TGGCCCGAGTGCCCACAGGGAGG + Intronic
1129296380 15:74602487-74602509 AGCCCTTGCTGCCCACTGGGAGG - Intronic
1129678569 15:77645311-77645333 AGGCCCCAGGGCCCACAGTGGGG + Intronic
1132644132 16:990969-990991 AGGCGGCTGTGCCCACAGTGGGG + Intergenic
1132684155 16:1155295-1155317 AGGCCTCTGTAGCCTCAGGGTGG + Intronic
1132872687 16:2122802-2122824 AGGCCACGGTGAACACAGGCAGG + Intronic
1132886464 16:2184336-2184358 TGGGCTCTGTGCCCACAGGCAGG + Intronic
1133646879 16:7773020-7773042 AGGGCTGGGTGCCCAGAAGGAGG + Intergenic
1134551779 16:15142001-15142023 AGGCCACGGTGAACACAGGCAGG + Intergenic
1136275612 16:29177737-29177759 TGGCCTGGGAGGCCACAGGGAGG - Intergenic
1139863772 16:70048158-70048180 AGGCCTCAGTGCTGACAGTGAGG + Intergenic
1141663237 16:85452925-85452947 GACCCTCAGTGCCCACAGGGTGG - Intergenic
1142964522 17:3572346-3572368 AGGCCTAGATGCCTCCAGGGTGG + Intronic
1143461444 17:7106974-7106996 AGGCCACGCTTCCCACAGGCAGG - Intronic
1143649900 17:8256899-8256921 AGGCCGCGGGGCCCACGTGGTGG + Exonic
1144654727 17:17028358-17028380 TGGCCTCAGTCCACACAGGGTGG - Intergenic
1146329756 17:31917440-31917462 CGGCCTCCCTGTCCACAGGGAGG + Intergenic
1148908738 17:50928330-50928352 AGGCCTGGGTGCCCATCTGGGGG - Intergenic
1152206965 17:78979407-78979429 AGGCCTATGTGCAAACAGGGAGG + Intronic
1152252387 17:79218808-79218830 AGGCCTCGGTGCAGACATGGAGG + Intronic
1152677287 17:81648177-81648199 GGCCCTCGCTGCCCGCAGGGGGG + Exonic
1152766768 17:82145683-82145705 AGGCCCCTCTGCCCACAGAGTGG - Intronic
1153956636 18:10102005-10102027 AAGCCTCTGTGCCCACAGGTGGG + Intergenic
1155053879 18:22169227-22169249 TGGGCTCGGTGCCCCCCGGGTGG + Intergenic
1156268062 18:35506032-35506054 AGGCCTTGGTGGGGACAGGGTGG + Intergenic
1160355119 18:78221258-78221280 AGGCCTTGGTGCCCACACGATGG + Intergenic
1160552732 18:79705367-79705389 AGGCTACGGTGCCCTCTGGGAGG + Intronic
1160767603 19:815351-815373 AGGCCTCGGTGCCCACAGGGAGG + Intronic
1160767654 19:815522-815544 TGGCTGCGGTGCCCACAGGCTGG + Intronic
1160899524 19:1420584-1420606 GGGCCTCGGCGCTCACTGGGTGG - Intronic
1161027671 19:2044151-2044173 AGTCCTCTTTCCCCACAGGGTGG + Intronic
1161514786 19:4690329-4690351 AGGCCTCAGAGCCCCGAGGGAGG + Intronic
1162376055 19:10305870-10305892 GGGCCTCGGTGCCTCCTGGGTGG + Exonic
1163152817 19:15425021-15425043 AGGCCTCGGTGGCTGCGGGGCGG + Exonic
1165247448 19:34505444-34505466 AGTCCTGAGGGCCCACAGGGGGG - Exonic
1165730894 19:38143922-38143944 GGGCCCTGGTGGCCACAGGGAGG - Intronic
1166295846 19:41888874-41888896 AGGGCTGGGTGGGCACAGGGAGG + Intronic
1166383819 19:42369546-42369568 AGCCCTGGGCGCACACAGGGCGG - Exonic
1167338503 19:48900990-48901012 AGACCCCGGTGCCCGTAGGGCGG + Intronic
1168132957 19:54332483-54332505 AGGCCTCTGGGCTCAGAGGGAGG - Intergenic
925990621 2:9251379-9251401 AGGTCTGGGCCCCCACAGGGAGG - Intronic
926614702 2:14984288-14984310 AGGTCTCAGTGCCCATAAGGAGG - Intergenic
928181406 2:29071279-29071301 AGGCCTTTCTGCCCACAGGGGGG + Exonic
932492871 2:72132740-72132762 AGGCCTTGGGGGCCACAGTGGGG - Intronic
932771318 2:74502316-74502338 AGGCCTCCGTGCCACCAGTGGGG - Intronic
933264661 2:80169081-80169103 AGGCCTTGGTACCCATAGTGTGG - Intronic
933728327 2:85438600-85438622 AGGCCTTTGTGGCCACAGAGTGG - Intergenic
933940163 2:87238596-87238618 AGGCCTGTGTGCCCACTGGGTGG - Intergenic
934714304 2:96534732-96534754 ACGCCTCTGTGCCTACAGAGGGG - Intergenic
935699180 2:105796182-105796204 AAGCCACAGTGCCCAGAGGGCGG - Intronic
936292768 2:111239161-111239183 AGGCCCAGGCACCCACAGGGAGG - Intergenic
936352977 2:111727182-111727204 AGGCCTGTGTGCCCACTGGGTGG + Intergenic
937292640 2:120790817-120790839 AGGCCTCAGACCCCACAGGCAGG + Intronic
945963129 2:216156866-216156888 TGGGCTCGGTGCCCACTGGAAGG + Intronic
946353140 2:219168692-219168714 AGGGCTCTCTGCCCACAGGGAGG - Exonic
1168762244 20:357173-357195 GGGCCTTGGAGGCCACAGGGAGG - Intronic
1170546183 20:17437262-17437284 GGGTCTCGGCGCACACAGGGCGG + Intronic
1171025330 20:21624957-21624979 TGGCCTGGCTGCCCACAGTGGGG - Intergenic
1171524027 20:25795977-25795999 AGGCCTGCGTGCCCATGGGGTGG - Intronic
1171552800 20:26059906-26059928 AGGCCTGCGTGCCCATGGGGTGG + Intergenic
1173949426 20:46978697-46978719 AGGCCCCGGTGGCCCCAGGGAGG + Intronic
1175936528 20:62516786-62516808 GGCCCTCGGTGCCCACTGAGGGG + Intergenic
1176108090 20:63398994-63399016 AGGAGTGGGTGCCCACAGGGAGG + Intergenic
1176253313 20:64137586-64137608 AGGCCTCGGAGGACACAGGGAGG + Intergenic
1179888703 21:44325397-44325419 AGGCCTCGGTCCCCTCACTGGGG - Intronic
1179921069 21:44507879-44507901 GGGCCACGGAGCCCACAGGCAGG + Intronic
1180167431 21:46037284-46037306 AGGTCATGGTGCCCACAGTGTGG - Intergenic
1180612958 22:17109373-17109395 AGTCCTCGGGGTCCACGGGGAGG - Exonic
1181031685 22:20151085-20151107 AGGCCTGGGTGCAGCCAGGGCGG + Intergenic
1181511719 22:23392425-23392447 AGGCCTGGGTGCAGCCAGGGAGG - Intergenic
1182000177 22:26913644-26913666 TGGCCCCGCTGCTCACAGGGTGG - Intergenic
1182439880 22:30356976-30356998 ACGCCGCGGTGCCCGCGGGGAGG - Exonic
1182605120 22:31496896-31496918 AGGATGCGGTGCCCCCAGGGCGG - Intronic
1182715693 22:32354694-32354716 GGGCCTCACTGCCCACAGAGGGG - Intergenic
1183464770 22:37973970-37973992 TGGCCTGGGTGCCCATTGGGCGG + Exonic
1184835403 22:47018088-47018110 AGGCCTCAGTGCCCAGAACGAGG - Intronic
1185339257 22:50284287-50284309 GGGACCCGGTGGCCACAGGGAGG - Intronic
1185390832 22:50560994-50561016 ATGCCTAGGTGCCCCTAGGGAGG - Intronic
950496233 3:13336064-13336086 AGGACTCTGTTCCCACTGGGTGG + Intronic
952959388 3:38580090-38580112 TGGCCTCTGGGACCACAGGGAGG + Intronic
956202690 3:66722751-66722773 AAGCCTAGGATCCCACAGGGAGG - Intergenic
956723554 3:72138803-72138825 AGGTCCCTGTGCCCAGAGGGTGG + Intergenic
961630837 3:128297208-128297230 AGGCCCCGGTCCCCCAAGGGAGG + Intronic
961639290 3:128354866-128354888 AGGCCTCCAGGCCCACTGGGAGG + Intronic
961809628 3:129514422-129514444 GGCCCTCGGTGCCTACAGGCTGG + Exonic
961815662 3:129548897-129548919 AGGCCTCGTTCCAAACAGGGGGG - Intronic
967884715 3:194325655-194325677 AAGCTTCTGTGGCCACAGGGTGG + Intergenic
968044462 3:195616282-195616304 AGGCCACGGTGAGCACAGGCAGG - Intergenic
968060251 3:195722333-195722355 AGGCCACGGTGAGCACAGGCAGG - Intronic
968428317 4:537553-537575 AGGCCGGGGACCCCACAGGGAGG - Intronic
968618425 4:1592771-1592793 TGCCATCGCTGCCCACAGGGAGG + Intergenic
968947553 4:3673401-3673423 AGACCACGGTGCCCCCAGAGTGG - Intergenic
969617412 4:8261859-8261881 AGGCGTCGCTGCCCCCAGGCCGG - Intergenic
972332895 4:38080193-38080215 TGACCTCTGTGCCCACAGTGAGG + Intronic
980450001 4:132958656-132958678 AGGCCTAGTTGCCCACAGGCAGG + Intergenic
980652580 4:135738192-135738214 AAGGATAGGTGCCCACAGGGAGG + Intergenic
984044244 4:174778145-174778167 AGGCCTTGGCGCTCACTGGGAGG - Intronic
984924032 4:184791078-184791100 TGGCCTGGCCGCCCACAGGGAGG + Intronic
995841754 5:116448601-116448623 AGGCTCCGGTGGCCACAAGGGGG - Intronic
998095381 5:139393284-139393306 CGTCCAGGGTGCCCACAGGGTGG + Exonic
1001952500 5:175826064-175826086 AGGGCTTGGTGCAGACAGGGTGG + Intronic
1001997449 5:176173704-176173726 AGGCCTTGGTGCCCTGTGGGTGG - Intergenic
1002089319 5:176795094-176795116 AGGCCTCGGTGGGCAAAGGGAGG + Intergenic
1002445547 5:179287966-179287988 AAGCCTCGGTTCCCCCAGAGGGG + Intronic
1002796563 6:475614-475636 AGATCTTGGGGCCCACAGGGAGG + Intergenic
1004322386 6:14642136-14642158 AGGCCTCGCTTCCCCCTGGGTGG - Intergenic
1005931826 6:30490165-30490187 AGGCCAAAATGCCCACAGGGTGG + Intronic
1007165111 6:39823723-39823745 AGCCCTGGATGCCCCCAGGGTGG - Intronic
1008384782 6:50876203-50876225 AAGCCCCAGTCCCCACAGGGTGG - Intergenic
1011546140 6:88483493-88483515 AGGCCCTGGGGCCCACAGAGAGG + Intergenic
1016229440 6:141784984-141785006 AGTCCCCGGTGCCCAAAGGTTGG - Intergenic
1019275013 7:171619-171641 AGGCCGGGGTGGCCACAGGTGGG - Intergenic
1019576883 7:1741841-1741863 AGGCCTCGCTGCCCAGACAGGGG + Intronic
1022476742 7:30716013-30716035 AGACCAGGGTGCCCTCAGGGAGG - Intronic
1023663370 7:42493732-42493754 AGGGCTGGGTTCCCAGAGGGCGG - Intergenic
1026006208 7:66602162-66602184 TGGCCCCAGTGCCCACAGGATGG - Intergenic
1028638967 7:93022159-93022181 GGGCATCAGTGCCCACAGGTGGG - Intergenic
1029513682 7:101012747-101012769 AGGCCTGGCTACCCCCAGGGAGG + Intronic
1029582710 7:101447974-101447996 CTGCCTCGGTGCCCACGGGCAGG - Intronic
1034420870 7:150989961-150989983 AGCACTCTGTGGCCACAGGGAGG - Intergenic
1039886022 8:41654247-41654269 TCGCCTCGGTGCCATCAGGGAGG - Intronic
1041693654 8:60714258-60714280 AGGCCACGGTGCCGGCAGCGAGG - Intronic
1044622076 8:94200593-94200615 AGGCCTCGGTTCCCAAACTGTGG + Intronic
1045546411 8:103133049-103133071 GGGCCTTGGTGCACACAGGCAGG - Exonic
1049689685 8:143953114-143953136 CCGCTTCGGTTCCCACAGGGTGG - Intronic
1054148736 9:61583733-61583755 GGGTCTCGGTGCTCACCGGGAGG - Intergenic
1054468498 9:65514862-65514884 GGGTCTCGGTGCTCACCGGGAGG - Intergenic
1057819197 9:98318276-98318298 AGGCCTTGCTGCCCAAAGGGTGG - Intronic
1060175319 9:121493315-121493337 AGCCCTCGGTGGGCACAGGTAGG - Intergenic
1060224984 9:121785043-121785065 AGGCCTCTGTGCTAGCAGGGAGG - Exonic
1061277643 9:129578733-129578755 TGGCCTCGGAGCCCAGACGGCGG - Intergenic
1061626654 9:131844378-131844400 AGGACTCGGTGGCCAGAGGGCGG + Intergenic
1062045662 9:134423349-134423371 AGGCGGCGGAGCCCACAGTGCGG - Intronic
1062318691 9:135980083-135980105 AGGCCTGGGTGGCCTCAGGACGG - Intergenic
1062684370 9:137802717-137802739 AGGCCTGCGTGCCTGCAGGGAGG - Intronic