ID: 1160768107

View in Genome Browser
Species Human (GRCh38)
Location 19:817596-817618
Sequence CCTTGTTATGGCATCTTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 224}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160768101_1160768107 11 Left 1160768101 19:817562-817584 CCTTGCTCAGGCATGGCCCCAGT 0: 1
1: 0
2: 2
3: 19
4: 228
Right 1160768107 19:817596-817618 CCTTGTTATGGCATCTTAGCAGG 0: 1
1: 0
2: 1
3: 11
4: 224
1160768103_1160768107 -6 Left 1160768103 19:817579-817601 CCCAGTCGTAATTTCTGCCTTGT 0: 1
1: 0
2: 0
3: 6
4: 113
Right 1160768107 19:817596-817618 CCTTGTTATGGCATCTTAGCAGG 0: 1
1: 0
2: 1
3: 11
4: 224
1160768104_1160768107 -7 Left 1160768104 19:817580-817602 CCAGTCGTAATTTCTGCCTTGTT 0: 1
1: 0
2: 0
3: 8
4: 139
Right 1160768107 19:817596-817618 CCTTGTTATGGCATCTTAGCAGG 0: 1
1: 0
2: 1
3: 11
4: 224
1160768102_1160768107 -5 Left 1160768102 19:817578-817600 CCCCAGTCGTAATTTCTGCCTTG 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1160768107 19:817596-817618 CCTTGTTATGGCATCTTAGCAGG 0: 1
1: 0
2: 1
3: 11
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160768107 Original CRISPR CCTTGTTATGGCATCTTAGC AGG Intronic
903087086 1:20871387-20871409 TATTGGTATGGCATCTTAGTGGG - Intronic
903995656 1:27303983-27304005 CCTTGTTATGGCCTCATAAATGG - Intronic
909286434 1:73825976-73825998 TCTTCTTATGGCATATCAGCTGG - Intergenic
909948264 1:81688743-81688765 CCTTGTTTTGTCATATTACCAGG + Intronic
910663329 1:89697084-89697106 ATTTGTTATGGCATCATAGAAGG - Intronic
913493612 1:119405782-119405804 CCTTGTTTTGTCATATTACCAGG - Intergenic
914927268 1:151899006-151899028 CCTTGTTTTGTCATATTACCTGG - Intronic
915821589 1:159030368-159030390 CCTTGTTTTGACATATTACCAGG + Intronic
916263861 1:162869775-162869797 CCTTGTTTTGTCATATTACCAGG - Intergenic
917057785 1:171003315-171003337 CCTTGTTTTGTCATATTACCAGG + Intronic
917461677 1:175235483-175235505 CCTTGTTTTGTCATATTACCAGG - Intergenic
923177857 1:231485663-231485685 CCATGTTATGGCATCTGAAAGGG + Intergenic
923561808 1:235047413-235047435 CCTGGTTCTGGCATCAAAGCAGG - Intergenic
923648333 1:235846440-235846462 CCTTGTTTTGTCATATTACCAGG - Intronic
923661726 1:235962819-235962841 CCTTGTTTTGTCATATTACCAGG - Intergenic
923808553 1:237287884-237287906 CCTTGTTTTGTCATATTACCAGG + Intronic
1065095605 10:22277947-22277969 CCTTGGTATAGCTCCTTAGCAGG + Intergenic
1065470857 10:26080625-26080647 CCTTGTTTTGTCATATTACCAGG + Intronic
1068040720 10:51820598-51820620 CCTTGCTATGGCTTCAGAGCAGG + Intronic
1068173067 10:53421622-53421644 CCTTGTTTTGTCATATTACCAGG + Intergenic
1069242606 10:66162278-66162300 CCTTGTTTTGTCATATTACCAGG + Intronic
1073578985 10:104646660-104646682 CCTTCTTTTGGCCTCTTGGCTGG + Intronic
1075660515 10:124192655-124192677 CCTTGTTTTGTCATATTACCAGG + Intergenic
1077972383 11:7208121-7208143 CCTTGTCATTGCATCCTATCAGG - Intergenic
1078288695 11:9983995-9984017 CCTTGTTTTGTCATATTACCAGG - Intronic
1078676658 11:13424688-13424710 CCTTGTTATTCTATCTTGGCTGG - Intronic
1079819876 11:25112789-25112811 CCTTCTTAGTGCATCTTATCTGG + Intergenic
1080402399 11:31947956-31947978 CCTTGTTTTGTCATATTACCAGG - Intronic
1081195359 11:40153357-40153379 CCTTGTTTTGTCATATTACCAGG - Intronic
1082266738 11:50127379-50127401 CCTTGTCTTTACATCTTAGCTGG + Intergenic
1082289351 11:50351189-50351211 CCTTGTCTTTACATCTTAGCTGG - Intergenic
1084230297 11:67747463-67747485 CTTTGTTATGGCAGCTAGGCTGG + Intergenic
1084504128 11:69554466-69554488 CCTTTTTATTGCATCTTCTCGGG - Intergenic
1087520828 11:99233306-99233328 CCTTGTTATGGGATTTTCACTGG - Intronic
1088206520 11:107398095-107398117 CCTTGTTTTGTCATATTACCAGG - Intronic
1089107484 11:116024681-116024703 CCTTGTTTTGTCATATTACCAGG - Intergenic
1089456587 11:118629369-118629391 CCTGGAGATGGCATCTGAGCTGG + Intronic
1089826193 11:121280500-121280522 CCTTGTTCTGTCATATTACCAGG + Intergenic
1090152601 11:124401676-124401698 CCTTTTGGTGGCATCTAAGCTGG - Intergenic
1090757407 11:129804415-129804437 CCTTGTTTTGTCATATTACCAGG - Intergenic
1091210426 11:133853882-133853904 CCTTGTTTTGTCATATTACCAGG + Intergenic
1091437206 12:481925-481947 CATTGATACGGCATCTTAGATGG + Intronic
1093172685 12:15876614-15876636 CCTTGTTTTGTCATATTACCAGG - Intronic
1093720669 12:22438011-22438033 CCTTGTTTTGTCATATTACCAGG - Intergenic
1094362215 12:29641658-29641680 CCTTGTTTTGTCATATTATCAGG - Intronic
1096123752 12:49105195-49105217 CCTAGTTTTGGCATCATACCTGG - Intronic
1096283875 12:50281356-50281378 CATTTTGAGGGCATCTTAGCAGG + Intronic
1097277955 12:57825952-57825974 CCTGGTTAAGGTATCTTAACAGG + Intronic
1097385865 12:58949819-58949841 CCTTGTTTTGTCATATTACCAGG + Intergenic
1098359064 12:69637562-69637584 CTTTGTTATAGCATTTCAGCTGG - Intergenic
1099429755 12:82569135-82569157 CATTTTTCTGTCATCTTAGCTGG + Intergenic
1101209148 12:102519109-102519131 CCTTGCCATGGCCTCTTCGCGGG - Intergenic
1102916638 12:116759433-116759455 CCTTGTTTTGTCATATTACCAGG + Intronic
1104504406 12:129318216-129318238 CCTTGTTTTGTCATATTACCAGG + Intronic
1104807161 12:131596957-131596979 TCTTGTGATGGGATCTCAGCAGG - Intergenic
1107273801 13:38653861-38653883 CCTTGTTAGAGCATCTATGCAGG - Intergenic
1107755896 13:43622319-43622341 CCTTGTTTTGTCATATTACCAGG + Intronic
1108017915 13:46095522-46095544 GCTTGATGTGGCATCTTTGCCGG + Intronic
1109047802 13:57436569-57436591 CCTTGTTTTGTCATATTACCAGG + Intergenic
1110561961 13:76918671-76918693 CCTTGTTTTGTCATATTACCAGG - Intergenic
1112035254 13:95491738-95491760 CCTTGTTTTGTCATATTACCAGG + Intronic
1113269841 13:108661858-108661880 CCTTGTTTTGTCATATTACCAGG + Intronic
1116088901 14:40278789-40278811 CCTTGTTTTGTCATATTACCAGG + Intergenic
1117510688 14:56448211-56448233 CCTTGTTTTGTCATATTATCAGG + Intergenic
1121459964 14:94066902-94066924 CCTTGTTTTGTCATATTACCAGG - Intronic
1124557230 15:30737024-30737046 CCTTGTTTGGTCATCTTAGCAGG - Intronic
1124656528 15:31513655-31513677 CCTTCTTGTGACATCTTATCAGG + Intronic
1124674034 15:31668723-31668745 CCTTGTTTGGTCATCTTAGCAGG + Intronic
1124695131 15:31858085-31858107 CCTTGTTATTTTATCTTGGCAGG - Intronic
1125055835 15:35358456-35358478 CCTTGTTTTGTCATATTACCAGG + Intronic
1126460673 15:48912663-48912685 CCTTGTTTTGTCATATTACCCGG + Intronic
1127049150 15:55062335-55062357 TCTTGTTATTCCATCTTGGCTGG - Intergenic
1128238833 15:66085743-66085765 CCTTGTTTTGTCATATTACCAGG - Intronic
1128415121 15:67437474-67437496 CCTTGTTTTGTCATATTACCAGG - Intronic
1129243846 15:74268083-74268105 CCTTGTTATCACATCTTTACTGG + Intronic
1129747236 15:78031739-78031761 CCTTGTTATTCCATCTTCACTGG - Intronic
1130180263 15:81619928-81619950 CCTTGTTCTGTCATTTGAGCAGG - Intergenic
1133106458 16:3513214-3513236 CCTTGTTATGGAATGTGACCTGG + Intronic
1141356534 16:83351976-83351998 CCTTGCTATGGAATCCTTGCTGG + Intronic
1142182094 16:88676281-88676303 CTTTGTTATGGCAGCTGAGTGGG + Intergenic
1144139569 17:12335956-12335978 CCTTGTTTTGTCATATTACCAGG + Intergenic
1144438787 17:15263036-15263058 CCCTGTCCTGGCGTCTTAGCCGG + Intronic
1144600282 17:16606858-16606880 TCTTGTTATGCTATATTAGCAGG + Intergenic
1146516497 17:33493765-33493787 CCCTGTGCTGGGATCTTAGCTGG + Intronic
1148373467 17:47120116-47120138 CCTTGTTTTGGCTTCTCAGTGGG + Intronic
1150978349 17:70113931-70113953 CCTTCTCAAGGCCTCTTAGCAGG - Intronic
1155007831 18:21744740-21744762 CCTTGTTAGTGCATCGTACCAGG + Intronic
1157364497 18:47051394-47051416 CCTTGTTCTGTCACCTAAGCTGG - Intronic
1157540962 18:48506112-48506134 CCTTGTTTTGTCATATTACCAGG - Intergenic
1158002719 18:52637236-52637258 CCTTGTTTTGTCATATTACCAGG - Intronic
1158175139 18:54647427-54647449 CCTTGCTAGGGCCTCTTACCCGG - Intergenic
1160768107 19:817596-817618 CCTTGTTATGGCATCTTAGCAGG + Intronic
1165208062 19:34208262-34208284 CCTTGGTATTTCATCTAAGCAGG - Intronic
1166273924 19:41737989-41738011 CCTTGTTATCAGATTTTAGCTGG + Intronic
925097482 2:1218816-1218838 TCTTGTGATGGCTTCTTTGCTGG + Intronic
926987402 2:18639662-18639684 CTTTGTTTGGGCATCTCAGCTGG - Intergenic
927600955 2:24440332-24440354 CTGTGTTTTTGCATCTTAGCAGG - Intergenic
929753140 2:44738389-44738411 CCTTGTTACGCCATCTTTGCTGG + Intronic
931525115 2:63144829-63144851 CCTTGTTTTGTCATATTACCAGG + Intronic
932100555 2:68896005-68896027 CCTTGTTTTGTCATATTACCAGG + Intergenic
932954907 2:76339779-76339801 CTTTGTTGTAGCAACTTAGCAGG + Intergenic
938598155 2:132810845-132810867 CCTTGTTTTGTCATATTACCAGG + Intronic
939769661 2:146299447-146299469 CCTTGTTTTGTCATATTACCAGG - Intergenic
940172265 2:150842436-150842458 CCTTGTTTTGTCATATTACCAGG + Intergenic
941010054 2:160289141-160289163 CCTTGTTATGCATTTTTAGCAGG - Intronic
941018944 2:160387905-160387927 CCTGGCCCTGGCATCTTAGCTGG + Intronic
941498552 2:166239540-166239562 CCTTCTTTTTGCATCTTAGTAGG - Intronic
941627532 2:167845665-167845687 CCTTGTTTTGTCATATTACCAGG - Intergenic
941631521 2:167890530-167890552 CCTTGTTTTGTCATATTACCAGG + Intergenic
942926697 2:181441603-181441625 CCTTGTTATGGGATCATTGCTGG - Intergenic
943891195 2:193289642-193289664 CCTTGTTTTGTCATATTAACAGG + Intergenic
943922791 2:193730769-193730791 CATGGTTTGGGCATCTTAGCTGG - Intergenic
944528773 2:200648162-200648184 CCTTGTTTTGTCATGTTACCAGG + Intronic
946036557 2:216746865-216746887 CCTTGTTTTGTCATATTACCAGG - Intergenic
947456974 2:230264546-230264568 CCTTGTTTTGTCATATTACCAGG + Intronic
1170245653 20:14219600-14219622 CCTTGTTTTGTCATATTACCAGG + Intronic
1170375776 20:15699153-15699175 CCTTGTTTTGTCATATTACCAGG + Intronic
1171165697 20:22968112-22968134 CCTTGTTTTGTCATATTACCCGG - Intergenic
1171242255 20:23581431-23581453 CCTTGTTTTGTCATATTACCAGG + Intergenic
1171378542 20:24714229-24714251 CCTTGTTTTGTCATCTTACCAGG + Intergenic
1172575484 20:36004933-36004955 CCCTGTTATTCCATCTTGGCTGG + Intronic
1174285062 20:49466821-49466843 CTTTGTCATGGCTTCTCAGCAGG - Intronic
1175069176 20:56317141-56317163 CCTTGTTTTGTCATATTACCAGG - Intergenic
1175520569 20:59600064-59600086 CCTTGCTCTGGCCTCTTTGCAGG + Intronic
1177995247 21:28089375-28089397 CCTTGTTTTGTCATATTACCAGG + Intergenic
1178110726 21:29367510-29367532 CCTTGGCATGGCCTCCTAGCGGG - Intronic
1178298838 21:31434182-31434204 CCTTGTTACTGCATCTTAGCTGG - Intronic
1178429371 21:32505569-32505591 CTTTGTTATGGCAGCTGGGCTGG - Intronic
1179302537 21:40125191-40125213 CCATGTTCTGCCTTCTTAGCTGG - Intronic
1181410917 22:22718691-22718713 TCTTGTCATGGCAACTTAGTTGG - Intergenic
1183048266 22:35239826-35239848 CCTTGTTTTGTCATATTACCAGG + Intergenic
949867939 3:8562168-8562190 CCTTGTCATGGTTTCTGAGCAGG + Intronic
951852003 3:27151573-27151595 CCTTGTTTTGTCATATTACCAGG - Intronic
955233748 3:57122080-57122102 CCTTGTTTTGCCATCTAAACTGG - Intronic
955856569 3:63278881-63278903 CCTTGGAACGGCATCTTAGGAGG - Intronic
957016301 3:75068882-75068904 CCTTGTTTTGTCATATTACCAGG + Intergenic
957046867 3:75382494-75382516 CTTTGTTATGGCAGCTGGGCTGG + Intergenic
958088205 3:88840293-88840315 CCTTGTTTTGACATATTACCAGG + Intergenic
958262885 3:91403552-91403574 CCTTGTTTTGTCATTTTACCAGG + Intergenic
959436233 3:106317964-106317986 CCTTGTTTTGTCATATTACCAGG - Intergenic
959899157 3:111640047-111640069 CCTTGTTTTGTCATATTACCAGG - Intronic
963708717 3:148721433-148721455 CCCTGTTATTCCATCTTGGCTGG - Intronic
965351423 3:167616293-167616315 CCTTGTTATGCCATCATGGCTGG - Intronic
968991161 4:3913609-3913631 CTTTGTTATGGCAGCTGGGCTGG + Intergenic
969271947 4:6108947-6108969 CCTTGTTCTGGCAGCTGAGAGGG + Intronic
970658526 4:18259611-18259633 CCTTGTTTTGTCATATTACCAGG + Intergenic
973787176 4:54342768-54342790 CCTTGTTTTGTCATATTACCAGG - Intergenic
973852845 4:54977898-54977920 CCATTTTATGGCAGCTAAGCTGG - Intergenic
975517353 4:75260906-75260928 CCTTGTTTTGTCATATTACCAGG - Intergenic
975680308 4:76868944-76868966 CCTTGTTTTGTCATATTACCAGG - Intergenic
976856585 4:89610844-89610866 CCTTGTTTTGTCATATTACCAGG - Intergenic
979638478 4:122984048-122984070 CCTTGTTTTGGCATGTTACCAGG - Intronic
980153122 4:129072875-129072897 CCTTGTTTTGTCATATTATCAGG + Intronic
980761860 4:137244984-137245006 TCTTGTGATGGCCTCTTAACTGG - Intergenic
981400877 4:144312977-144312999 CCTTGTTTTGTCATATTACCAGG + Intergenic
981461208 4:145015004-145015026 CCTTGTTTTGTCATATTACCAGG - Intronic
981626090 4:146757104-146757126 CCTTGTTTTGTCATATTATCAGG + Intronic
981760690 4:148192059-148192081 CCTTGTTTTGCCATATTACCAGG + Intronic
982189835 4:152842990-152843012 CCTTGTTTTGTCATATTACCAGG + Intronic
982680043 4:158418471-158418493 CCTTGTTTTGTCATATTACCAGG + Intronic
985240701 4:187928827-187928849 CCTTGTTTTGTCATATTACCAGG + Intergenic
987704285 5:21443729-21443751 CCTTGTTTTGTCATATTACCAGG + Intergenic
988902330 5:35746239-35746261 CCTTGTTTTGTCATATTACCAGG - Intronic
991387060 5:66101769-66101791 CCTTGTTTTGTCATATTAGCAGG - Intergenic
991667139 5:69010647-69010669 ACTTCTTGTGGCATCTCAGCAGG - Intergenic
992360063 5:76028320-76028342 CCCTGTTTTGCCATCTTGGCTGG + Intergenic
993250238 5:85512696-85512718 CCTTGTTTTGTCATATTACCAGG + Intergenic
995472909 5:112522689-112522711 CCTTGTTTTGTCATATTACCAGG + Intergenic
996124045 5:119705510-119705532 CCTTGTTTTGTCATATTACCAGG + Intergenic
996325509 5:122268086-122268108 CCTTGTTTTGTCATATTACCAGG - Intergenic
996481557 5:123981291-123981313 CCTTGTTAGAGAATCTGAGCTGG + Intergenic
996616053 5:125441997-125442019 CCTTGTTTTGTCATATTACCAGG - Intergenic
997758920 5:136425894-136425916 CCTTGATATGATATCTAAGCAGG - Intergenic
999517438 5:152315222-152315244 CATTGTTATAGCCTCTTAACTGG - Intergenic
999818715 5:155202662-155202684 CCTTGTTTTGTCATATTACCAGG - Intergenic
1002382851 5:178842690-178842712 GCTTGTTCTGGCATCCTGGCTGG - Intergenic
1002813952 6:660717-660739 CCTTGTTTTGTCATATTACCGGG - Intronic
1007205650 6:40148474-40148496 TCTTGTTTTGGCATCTTGGGAGG - Intergenic
1008305421 6:49893005-49893027 CCTTGTTTTGTCATATTACCAGG - Intergenic
1009339421 6:62535063-62535085 CCATGTTATTGCGTATTAGCAGG - Intergenic
1009601655 6:65808890-65808912 CCTTGCTCTGTCATCTGAGCTGG + Intergenic
1010076262 6:71802784-71802806 CCTTGTTTTGTCATATTACCAGG + Intergenic
1011260551 6:85465814-85465836 CTCTGTAATGGCATGTTAGCAGG - Intronic
1012922773 6:105236019-105236041 CCTTGTTCTGTCATATTACCAGG - Intergenic
1013720947 6:113027789-113027811 CCTTGTTTTGTCATATTACCAGG + Intergenic
1014336923 6:120148046-120148068 CCTTGTTTTGTCATATTACCAGG - Intergenic
1015877872 6:137842446-137842468 CCTTGTTTTGTCATATTACCAGG + Intergenic
1016793712 6:148095052-148095074 CCTTGGGATGGCATTCTAGCCGG - Intergenic
1018114846 6:160573498-160573520 CCTTGTTTTGTCATATTACCAGG + Intronic
1020313997 7:6891496-6891518 CTTTGTTATGGCAGCTGGGCTGG + Intergenic
1020860891 7:13490158-13490180 CCTTGTTTTGTCATATTACCAGG - Intergenic
1021937103 7:25641852-25641874 CCTTGCTATGGCTTCTTGGTAGG + Intergenic
1023701363 7:42894186-42894208 CCTTGTTTTGTCATATTACCTGG - Intergenic
1024204442 7:47144684-47144706 CCTTGCTCTGCCATCTCAGCTGG + Intergenic
1024455864 7:49605634-49605656 CCTTGTTTTGTCATATTACCAGG - Intergenic
1024669194 7:51576895-51576917 CCTTGTTTTGTCATATTACCAGG + Intergenic
1026337307 7:69405514-69405536 TCTTGTTATCGCCTCTTAACTGG + Intergenic
1027350353 7:77305783-77305805 CCTTGTTTTGTCATATTACCAGG + Intronic
1030936098 7:115585969-115585991 CCTTGTTTTGTCATATTACCAGG - Intergenic
1031880051 7:127187558-127187580 GCCAGTTATGGCCTCTTAGCTGG - Intronic
1032097940 7:128948801-128948823 CCTTGTTATTGCATGCCAGCTGG - Exonic
1033262809 7:139858219-139858241 CCATGTTGTGGCACCATAGCAGG - Intronic
1037700283 8:21267586-21267608 CCTTTTTATGCCATCTTGGCTGG - Intergenic
1039641569 8:39228247-39228269 CCTTGTTTTGTCATATTACCAGG - Intronic
1041570442 8:59332488-59332510 CCTTGTTTTGTCATATTACCAGG + Intergenic
1042467027 8:69140220-69140242 CCTTGTTTTGTCATATTACCAGG + Intergenic
1044227705 8:89737577-89737599 CCTTGTTTTGTCATATTACCAGG - Intergenic
1044812436 8:96077459-96077481 CCCTGTTATGACATCTTATATGG + Intergenic
1049295885 8:141837448-141837470 CCTTGTTTTGTCATATTACCAGG + Intergenic
1050345334 9:4680056-4680078 CCCTTTTATGGCATCTTCGGAGG + Intronic
1050502791 9:6315890-6315912 CCTTGTTTTGTCATATTACCGGG - Intergenic
1051687589 9:19674929-19674951 CCTTGTTTTGTCATATTACCAGG + Intronic
1054486213 9:65726318-65726340 CCTTGTTTTGTCATATTACCAGG - Intronic
1057119392 9:92558213-92558235 CCTTGTTTTGTCATATTACCAGG + Intronic
1058156625 9:101523808-101523830 CCTTGTTTTGTCATATTACCAGG + Intronic
1058623107 9:106904995-106905017 CCTTGTTTTGTCATATTACCAGG + Intronic
1186489938 X:9963676-9963698 CCTTGTTTTTGCATCTTTTCTGG - Intergenic
1187773506 X:22729915-22729937 CCTTGTTTTGTCATATTACCAGG + Intergenic
1189879082 X:45470767-45470789 CCTTGTTTTGTCATATTACCAGG + Intergenic
1190449030 X:50558635-50558657 CCTTGTTTTGTCATATTACCAGG - Intergenic
1190895375 X:54613508-54613530 CCTTGTTGTGTCATATTACCAGG + Intergenic
1191151715 X:57227221-57227243 CCTTGTTTTGTCATATTACCAGG + Intergenic
1192235262 X:69291559-69291581 CCTTGTGATAGGATCTCAGCGGG + Intergenic
1192881004 X:75284369-75284391 CCTTGTTATGTAATATTACCAGG + Intronic
1192978948 X:76318522-76318544 CCTTGTTTTGTCATATTACCAGG + Intergenic
1193154695 X:78159476-78159498 CCTTGTTTTGTCATATTACCAGG - Intergenic
1193643786 X:84043414-84043436 CCTTGTTTTGTCATATTACCAGG + Intergenic
1193886810 X:86993105-86993127 CCCTGTTACTTCATCTTAGCAGG + Intergenic
1194190361 X:90827856-90827878 CCTTGTTATGAAATCTTTGCTGG + Intergenic
1194757703 X:97757154-97757176 CCTTATTATGGCATGTAAGTGGG + Intergenic
1194926815 X:99835926-99835948 CCTTGTTTTGTCATATTACCAGG + Intergenic
1196590394 X:117480916-117480938 CCTTGTTTTGTCATATTACCAGG + Intergenic
1197589010 X:128384821-128384843 CCTTGTTTTGTCATATTACCAGG - Intergenic
1199057741 X:143318465-143318487 CCTTGTTTTGTCATATTACCAGG + Intergenic
1199668639 X:150121862-150121884 CCTTGTTTTGTCATATTACCAGG - Intergenic
1200537016 Y:4410276-4410298 CCTTGTTATGAAATCTTTGCTGG + Intergenic
1202043752 Y:20714901-20714923 CCTTGTTTTGTCATATTACCAGG - Intergenic