ID: 1160769055

View in Genome Browser
Species Human (GRCh38)
Location 19:822141-822163
Sequence CCTGAGACCCCCGAGACCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 258}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160769055_1160769057 -10 Left 1160769055 19:822141-822163 CCGGGGGTCTCGGGGGTCTCAGG 0: 1
1: 0
2: 2
3: 22
4: 258
Right 1160769057 19:822154-822176 GGGTCTCAGGTCTGCGCGAGCGG No data
1160769055_1160769062 4 Left 1160769055 19:822141-822163 CCGGGGGTCTCGGGGGTCTCAGG 0: 1
1: 0
2: 2
3: 22
4: 258
Right 1160769062 19:822168-822190 CGCGAGCGGCTGGCGGGGCTCGG No data
1160769055_1160769060 -2 Left 1160769055 19:822141-822163 CCGGGGGTCTCGGGGGTCTCAGG 0: 1
1: 0
2: 2
3: 22
4: 258
Right 1160769060 19:822162-822184 GGTCTGCGCGAGCGGCTGGCGGG No data
1160769055_1160769061 -1 Left 1160769055 19:822141-822163 CCGGGGGTCTCGGGGGTCTCAGG 0: 1
1: 0
2: 2
3: 22
4: 258
Right 1160769061 19:822163-822185 GTCTGCGCGAGCGGCTGGCGGGG No data
1160769055_1160769067 28 Left 1160769055 19:822141-822163 CCGGGGGTCTCGGGGGTCTCAGG 0: 1
1: 0
2: 2
3: 22
4: 258
Right 1160769067 19:822192-822214 GGTCGCGTCCTCCTCCCTTCGGG No data
1160769055_1160769065 7 Left 1160769055 19:822141-822163 CCGGGGGTCTCGGGGGTCTCAGG 0: 1
1: 0
2: 2
3: 22
4: 258
Right 1160769065 19:822171-822193 GAGCGGCTGGCGGGGCTCGGGGG No data
1160769055_1160769064 6 Left 1160769055 19:822141-822163 CCGGGGGTCTCGGGGGTCTCAGG 0: 1
1: 0
2: 2
3: 22
4: 258
Right 1160769064 19:822170-822192 CGAGCGGCTGGCGGGGCTCGGGG No data
1160769055_1160769066 27 Left 1160769055 19:822141-822163 CCGGGGGTCTCGGGGGTCTCAGG 0: 1
1: 0
2: 2
3: 22
4: 258
Right 1160769066 19:822191-822213 GGGTCGCGTCCTCCTCCCTTCGG No data
1160769055_1160769059 -3 Left 1160769055 19:822141-822163 CCGGGGGTCTCGGGGGTCTCAGG 0: 1
1: 0
2: 2
3: 22
4: 258
Right 1160769059 19:822161-822183 AGGTCTGCGCGAGCGGCTGGCGG No data
1160769055_1160769063 5 Left 1160769055 19:822141-822163 CCGGGGGTCTCGGGGGTCTCAGG 0: 1
1: 0
2: 2
3: 22
4: 258
Right 1160769063 19:822169-822191 GCGAGCGGCTGGCGGGGCTCGGG No data
1160769055_1160769058 -6 Left 1160769055 19:822141-822163 CCGGGGGTCTCGGGGGTCTCAGG 0: 1
1: 0
2: 2
3: 22
4: 258
Right 1160769058 19:822158-822180 CTCAGGTCTGCGCGAGCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160769055 Original CRISPR CCTGAGACCCCCGAGACCCC CGG (reversed) Intergenic
900290587 1:1922000-1922022 CCTCAGAGCCCCCAGCCCCCAGG - Exonic
900346927 1:2214551-2214573 CCTAAGTCACCCAAGACCCCCGG + Intergenic
900356666 1:2268286-2268308 CCTGAGCCCTCTGAGACACCTGG - Intronic
900787223 1:4656252-4656274 CCAGAGAAGCCCGAGAACCCCGG - Intronic
902184884 1:14717707-14717729 CCTGAGGCCCAAGAGGCCCCTGG + Intronic
902331645 1:15733906-15733928 GCCGAGCCTCCCGAGACCCCTGG + Exonic
902506160 1:16939872-16939894 TCTGTGACCCCCCACACCCCAGG + Exonic
903379346 1:22885993-22886015 CCTGAGGCCTCCGAGCCACCTGG - Intronic
903447558 1:23431861-23431883 CCTGAGACCCCTGAGAGCCTGGG - Exonic
904984046 1:34530029-34530051 CCTGAGGCCCCAGAGACTCGGGG + Intergenic
905767092 1:40610279-40610301 CCTGTGACCCCTGAAGCCCCAGG - Intergenic
906209024 1:44002085-44002107 CCTGAGTCCTCACAGACCCCTGG + Intronic
906718465 1:47988004-47988026 CCCGAGGCCCCAGACACCCCTGG - Intronic
912079286 1:105914511-105914533 CCTGAGACTCACAAGGCCCCAGG - Intergenic
918428425 1:184434265-184434287 CCTGACACCACAGAGACCCTCGG - Intronic
920418233 1:205812857-205812879 CCTGCACCCCCCGAGACCACGGG - Exonic
920744460 1:208613465-208613487 CCAGAGTCCTCCGAGGCCCCTGG + Intergenic
923774234 1:236964201-236964223 CCTGAGAGCACAGTGACCCCTGG + Intergenic
924613158 1:245590263-245590285 CCCGGGACCCCAGGGACCCCGGG - Intronic
1062939732 10:1412202-1412224 CCTGCGAGCCCGGAGACCTCGGG + Intronic
1063013702 10:2052640-2052662 GGTGAGACCCCCGCCACCCCAGG - Intergenic
1063127669 10:3150052-3150074 CCAGGTGCCCCCGAGACCCCTGG + Intronic
1064285632 10:13989122-13989144 ACTGAGACCCCCCTCACCCCTGG - Intronic
1066488766 10:35873994-35874016 CCTGAGCCCCCCGAGGCTGCAGG - Intergenic
1069115303 10:64497534-64497556 CCCCAGACCCCAGGGACCCCAGG - Intergenic
1069817793 10:71209678-71209700 CCTCAGAACCCCCAGACCCCAGG + Intergenic
1069908520 10:71746339-71746361 CCTGAGACCCTCGTCCCCCCAGG + Intronic
1069979693 10:72243580-72243602 CCTTAGACCTACTAGACCCCAGG - Intergenic
1070604676 10:77890409-77890431 CCTGGGACCCTAGAGACCCAAGG - Intronic
1072555862 10:96513380-96513402 CCTGAGATCCCCGGCTCCCCCGG - Intronic
1073011690 10:100365079-100365101 CGTGACACACCCGAGAACCCTGG - Intergenic
1073209009 10:101783310-101783332 CCGTAGGCCCCCGACACCCCCGG + Exonic
1075098635 10:119490276-119490298 CCTGAGAGCCCCCCCACCCCTGG + Intergenic
1075777215 10:124996724-124996746 CCAGAGACCACCGAGGCCCCAGG + Intronic
1077142794 11:1031770-1031792 CCTCCGGCCCCCGAGCCCCCGGG + Intronic
1077247908 11:1548115-1548137 CAGGAGACCCCCGACAGCCCTGG - Intergenic
1078359832 11:10659491-10659513 CCTGAGAACCCCGACAATCCTGG + Intronic
1079104794 11:17563643-17563665 CCTGAGACCCAATAGCCCCCAGG - Intronic
1080889568 11:36397909-36397931 CCTCAGCCCCCCGAGTCGCCGGG + Intronic
1083256404 11:61498758-61498780 CCTGGGACCACAAAGACCCCAGG + Intergenic
1083331346 11:61899883-61899905 CCTGAGGCCCCAGGGGCCCCGGG - Intronic
1083883362 11:65558871-65558893 CCTGGGACCTCCGTGAGCCCTGG - Intronic
1087121728 11:94582042-94582064 CCTCAGACCCTCCAGTCCCCAGG - Intronic
1088326298 11:108604732-108604754 CCTGAGGGTCCTGAGACCCCAGG + Intergenic
1089695045 11:120211548-120211570 CCTGAGCCCCCCGGGATCCCAGG + Intronic
1090647453 11:128777234-128777256 GCTGGGAGCCCCGAGGCCCCGGG + Intronic
1090666679 11:128919046-128919068 CCTGGGACTCCCTGGACCCCAGG + Exonic
1093059707 12:14589631-14589653 CCTGGGCCCCCCAAGAACCCAGG + Intergenic
1094838943 12:34334953-34334975 CCGGGGACCCCAGAGTCCCCGGG - Intergenic
1097864944 12:64552240-64552262 CCTGAGACCCAGGAGAACTCGGG + Intergenic
1102115322 12:110398464-110398486 CCTGAAATCCCTGAGACTCCAGG - Intronic
1102903559 12:116657692-116657714 TCTGAGACCTCTGAGACCCCTGG + Intergenic
1103513470 12:121491009-121491031 CCTGGGAACCCAGAGACCCCGGG + Intronic
1104028819 12:125049505-125049527 CCCGAAACCACCGAGACTCCAGG - Intergenic
1104989656 12:132618624-132618646 CCTGGGACACCCGGGACTCCCGG + Intergenic
1105512206 13:21060855-21060877 CCTGACAGCCTCGGGACCCCCGG - Intronic
1105837579 13:24224349-24224371 CCTCAGAGCCCCCAGAGCCCCGG + Exonic
1105882395 13:24616003-24616025 CTTGGGGCCCCCGGGACCCCTGG + Intergenic
1106118621 13:26838657-26838679 CCTGATCCCCCTGAGACCCCCGG - Intergenic
1107411318 13:40161193-40161215 GCTGAGTCCCCAGGGACCCCAGG - Intergenic
1113785368 13:112999612-112999634 GCAGAGACCCCCGAGGCCCAAGG - Intronic
1113886944 13:113666007-113666029 CCTGAGACACCTGAGACAGCTGG - Intergenic
1122207986 14:100157673-100157695 CCTGAGGCCCCAGTTACCCCGGG + Intronic
1124800876 15:32831606-32831628 CATGAGACTCCCTAGACCACAGG + Intronic
1127753459 15:62068079-62068101 CCGGCGACCCCCGCGGCCCCCGG + Exonic
1128331280 15:66757299-66757321 TCTGACACCCCCTAGACACCAGG - Intronic
1128418268 15:67466601-67466623 CCTGAGCCCCCCAAGACATCAGG - Intronic
1128426056 15:67543127-67543149 CCTCAGACCCCCGACAGCCTGGG + Exonic
1128790083 15:70426776-70426798 CCTGTGACCCCCTAGATCACAGG - Intergenic
1129332229 15:74833554-74833576 CCTCAGACACCGGAGGCCCCAGG + Intergenic
1129333374 15:74838941-74838963 CCAGAGGCCCCCGAGATCTCCGG + Intronic
1131143815 15:89999506-89999528 CCTGAGCCCCCAATGACCCCAGG - Intergenic
1132878675 16:2151466-2151488 CCTGAGACCTCCCAGCTCCCAGG - Intronic
1132896559 16:2232105-2232127 CCAGAGACCCCAGAGACTGCTGG - Intronic
1132898255 16:2238948-2238970 TCTGAGAGCCCCGAGGGCCCAGG - Intergenic
1132977709 16:2718950-2718972 CCTGACACCCCCGGCACCCCTGG - Intronic
1133103218 16:3491605-3491627 CCTGAGGCCTCCCAGACACCTGG - Intergenic
1133532956 16:6672901-6672923 ACTGAATCCCCCTAGACCCCAGG + Intronic
1135801561 16:25501951-25501973 TCTGAGACCCCAGAGAAACCTGG + Intergenic
1136280824 16:29210172-29210194 GCTGAGACCCCCCAGCCCTCTGG - Intergenic
1136620862 16:31427756-31427778 CCTGAGGCCCCGGACGCCCCCGG - Exonic
1139761449 16:69187436-69187458 CCTGGGGCCCCCGAGCCCGCCGG + Exonic
1139871877 16:70114488-70114510 CCTAAGCGCCCCGGGACCCCTGG + Intronic
1140364050 16:74367995-74368017 CCTAAGCGCCCCGGGACCCCTGG - Intergenic
1141335184 16:83147773-83147795 CCTGTGACCCCAGAGACCAGTGG - Intronic
1141997936 16:87647120-87647142 CCTGGGCCCCCCAAAACCCCAGG - Intronic
1142085180 16:88176094-88176116 GCTGAGACCCCCCAGCCCTCTGG - Intergenic
1142243193 16:88956386-88956408 GCAGAGAGCCCTGAGACCCCTGG - Intronic
1142389540 16:89789885-89789907 CCTGAGACCTCAGGGATCCCTGG - Intronic
1142859051 17:2749788-2749810 CCCGGGAGCCCCGAGAGCCCCGG + Intergenic
1144523066 17:15967161-15967183 CCTGAGATGCCAGAGTCCCCAGG + Intronic
1147261075 17:39210121-39210143 ACTGAGCCCTCCCAGACCCCCGG + Intergenic
1148616473 17:49004192-49004214 TCTCAGATCCCTGAGACCCCAGG + Intronic
1149356594 17:55845716-55845738 CCTGGGACCCCCGGGACCCCGGG + Intergenic
1150283587 17:63943445-63943467 CCTGGGACCCCAGTGGCCCCTGG - Intronic
1150931270 17:69588144-69588166 CCTGAGCCTCCCGAGTCCCTTGG + Intergenic
1152229175 17:79106126-79106148 CCTGTGTCCCCCGGGCCCCCAGG - Intronic
1152732232 17:81977924-81977946 CTCGGGACCCCCGGGACCCCCGG - Intronic
1152751108 17:82062832-82062854 CATGACACCCCCGCGAGCCCAGG + Intronic
1153338485 18:3949378-3949400 CCTGAGACCACTGAAGCCCCAGG - Intronic
1156507715 18:37609056-37609078 CCTGAGGTCCCCGACACTCCAGG - Intergenic
1157427357 18:47595324-47595346 CCTGGGATCCACAAGACCCCTGG + Intergenic
1160348366 18:78153176-78153198 GCTGACACCCCCGAGACCCAGGG - Intergenic
1160769055 19:822141-822163 CCTGAGACCCCCGAGACCCCCGG - Intergenic
1160786343 19:901688-901710 ACAGAGACCACCTAGACCCCAGG + Intronic
1160799938 19:963091-963113 CCTGCTACCCCCGGAACCCCCGG - Intronic
1160906205 19:1452857-1452879 CCTGAGACCCCCCCCAACCCAGG + Exonic
1161315655 19:3616097-3616119 GCTGGGACCCCCTAAACCCCCGG - Intronic
1161590797 19:5128332-5128354 CCTGAGACCATCGATGCCCCAGG + Intronic
1162326722 19:10003854-10003876 CCTGAGCCACCCTTGACCCCAGG - Intronic
1163017827 19:14467604-14467626 TCGGAGACCCAGGAGACCCCAGG + Exonic
1163023459 19:14495981-14496003 CCCGCGACCCCCGAGGCCCCCGG + Intronic
1163561926 19:18024348-18024370 CCTAAGGCCTCCGAAACCCCAGG + Intergenic
1164617417 19:29675259-29675281 CCTGAGCTCCCCGAGGCCCAGGG + Exonic
1165328047 19:35125532-35125554 CCAGAGACCCCCGGGACCCCAGG - Intronic
1165419864 19:35717528-35717550 CCCGGGACCCCCGAGGCCCTGGG - Intergenic
1165706648 19:37980874-37980896 CCTGAAACCTCCCAGACACCAGG - Intronic
1165775051 19:38399333-38399355 CCTCAGACCCTGGAGCCCCCAGG + Intergenic
1166290486 19:41860360-41860382 CCTGAGGGCCCCGAGGCGCCCGG + Intronic
1166328900 19:42067570-42067592 CCTGAGACACCAGGGACTCCTGG + Intronic
1166895249 19:46018510-46018532 CCTCACACACCTGAGACCCCAGG - Exonic
1166945533 19:46393890-46393912 CCTAAGACCCCCGCTCCCCCCGG - Intergenic
1167409358 19:49335837-49335859 CCTGAGACAAGGGAGACCCCAGG - Intronic
1167428064 19:49439764-49439786 CTTGGGTCCCCAGAGACCCCCGG - Intronic
1167683307 19:50939398-50939420 CCAGAGTCCCCCCACACCCCTGG - Intergenic
1168267293 19:55229905-55229927 CCTCAGACCCTCAAGGCCCCTGG + Exonic
926072887 2:9914513-9914535 CCTGTCACCACTGAGACCCCAGG - Intronic
926159162 2:10475630-10475652 CCTGAGGCCTCGTAGACCCCAGG + Intergenic
926292549 2:11542318-11542340 CCTGAGACCCCGAAGGCCCCCGG + Intronic
926703521 2:15819995-15820017 CCTGAGCCCTCCCAGATCCCTGG + Intergenic
926919328 2:17925524-17925546 CCTGAGACCCCCTAGCCCTGCGG - Intronic
930012877 2:46951010-46951032 CCTGAGAGCCCCCTGACCCAAGG - Intronic
934618629 2:95790915-95790937 CCCGTGGCCCCCGAGACCCTGGG + Intergenic
934642264 2:96033642-96033664 CCCGTGGCCCCCGAGACCCTGGG - Intronic
936152469 2:110029429-110029451 CCTGAGGACCCAGAGACTCCAGG + Intergenic
936192211 2:110341983-110342005 CCTGAGGACCCAGAGACTCCAGG - Intergenic
936235508 2:110739365-110739387 CCTGAGACCTTGGAGGCCCCAGG + Intronic
936278604 2:111120326-111120348 CCTGAGTCCCGCGAGAGGCCCGG + Intronic
937986347 2:127639869-127639891 CCAGGGACCCCAGGGACCCCAGG - Intronic
943961138 2:194264941-194264963 CCTGAGGCCCCCGAGAGTGCAGG - Intergenic
944644246 2:201762768-201762790 CCAGAGGCCCCAGAGACCCTGGG + Intronic
947630410 2:231648934-231648956 CCTGGGCCCCCCTAGACTCCAGG - Intergenic
948381224 2:237551155-237551177 CATGAGGCCCCACAGACCCCGGG - Intronic
948676345 2:239599101-239599123 CCTGGGACCCTCTAGAGCCCAGG + Intergenic
948831175 2:240598921-240598943 ACTGAGACGGCAGAGACCCCAGG + Exonic
948840382 2:240645813-240645835 CCTGGGACCCTCCAGACCCTCGG - Intergenic
949080020 2:242088983-242089005 CCTGACGCGCCCGAGACCCCCGG - Intergenic
1169616468 20:7451844-7451866 CCTCAGGCCCCTGGGACCCCTGG - Intergenic
1170894967 20:20404578-20404600 CCTGAAGCTCCCGACACCCCGGG - Intronic
1172701284 20:36855080-36855102 GGTGTGACCCCCGTGACCCCAGG - Intronic
1173559255 20:43990776-43990798 CATGAGTGCCCCGAGATCCCAGG - Intronic
1175466229 20:59192575-59192597 CCAGGGAGCCCCGGGACCCCTGG + Exonic
1175466471 20:59193531-59193553 CCTGTGAGCGCAGAGACCCCAGG + Exonic
1175471445 20:59232494-59232516 CCTGGGACCCCCGAGACACTGGG + Intronic
1175763525 20:61577612-61577634 CCTGGGACCCCAGAGAACCCAGG - Intronic
1175845535 20:62056579-62056601 CCTGAGACCACCGAGGGCCAAGG + Intronic
1176089301 20:63311920-63311942 CCTGGCCCCCCCGAGACACCTGG + Exonic
1176223837 20:63983021-63983043 CAGGAGACCCCCAAGACACCGGG - Intronic
1176388884 21:6153595-6153617 CCTGGCACCCCCGAGAGCCGGGG - Intergenic
1176426745 21:6553027-6553049 CCTGCGGCCACCAAGACCCCAGG + Intergenic
1178916527 21:36708285-36708307 GCTGCGCCCCGCGAGACCCCAGG - Intronic
1178922497 21:36747835-36747857 CCCCCGACCCCCGAGGCCCCGGG + Exonic
1178942275 21:36915883-36915905 CGAGAGCCCCCAGAGACCCCAGG - Intronic
1179561501 21:42218916-42218938 CCTGCCACCCCGGAAACCCCGGG - Intronic
1179702236 21:43161349-43161371 CCTGCGGCCACCAAGACCCCAGG + Intronic
1179714025 21:43278647-43278669 ACTGAGTCCCCACAGACCCCAGG + Intergenic
1179734588 21:43384653-43384675 CCTGGCACCCCCGAGAGCCGGGG + Intergenic
1180172347 21:46066113-46066135 CCGGAGGCCCCCGGGACCCAGGG + Intergenic
1180708506 22:17824177-17824199 CCTGAGACCCACAGGACCACTGG + Intronic
1181985657 22:26798537-26798559 CCTGAGACCCACCAGGCCCCGGG - Intergenic
1183528148 22:38336308-38336330 CATGAGAACCACGAAACCCCCGG - Intronic
1183830307 22:40415332-40415354 CCTCAGACCCCAGGGACCCAGGG + Intronic
1184464449 22:44660608-44660630 CCAGAGCCCCCCGAGACCTCAGG - Intergenic
1184569068 22:45310540-45310562 CCTTAGCCCCGCGAGACCCCGGG + Intronic
1184886877 22:47351981-47352003 CCCGAGACCCCCCTGTCCCCTGG + Intergenic
1185059579 22:48599277-48599299 CCTGAGACTCCCTAGGGCCCTGG + Intronic
1185072163 22:48662316-48662338 CCTGGCACCCCCGAGGCTCCCGG - Intronic
1185216203 22:49601257-49601279 CCCCAGACCCCTGAGCCCCCTGG - Intronic
1185242049 22:49751919-49751941 CCAGAGCCCCCCCAGAACCCGGG + Intergenic
1185330978 22:50251912-50251934 CCTGAGGCCCCCTGGAGCCCAGG + Intronic
1185340340 22:50288136-50288158 TCTGAGGCTCCCGAGGCCCCGGG - Intronic
1185348515 22:50321193-50321215 GCTGTGACCCCCGGGATCCCAGG - Intronic
950712010 3:14819681-14819703 CAGGAGCCCCCCGACACCCCCGG + Exonic
952316902 3:32239135-32239157 GCTGAGCCCCCCGCCACCCCCGG - Intronic
952389087 3:32864629-32864651 CCTGACACCCCAGTGCCCCCAGG + Intronic
952916805 3:38252583-38252605 CCTCTGACCCCAGAGACCCTTGG + Intronic
954131506 3:48563600-48563622 CCAGAGATCCCAGAGTCCCCTGG + Intronic
954156038 3:48685473-48685495 CCTGAGACCCCCGGACCCACGGG - Intronic
954683591 3:52358837-52358859 CCTGAGCCCCCAGGGACCTCAGG - Intronic
955068700 3:55554558-55554580 CCTGAGACCATCCACACCCCAGG - Intronic
956388448 3:68746142-68746164 CCTGAGAGCCCAGAGCCCCTGGG - Intronic
956740663 3:72273274-72273296 CAGGAGACCCCAGAGACCCCGGG + Intergenic
956786797 3:72649490-72649512 TCTGTGACCCCATAGACCCCAGG - Intergenic
960316015 3:116178280-116178302 CCTCAGCCTCCCGAGAACCCGGG + Intronic
962474410 3:135742645-135742667 CCTGCAACCCCCGAAGCCCCAGG - Intergenic
962715433 3:138121945-138121967 CCTGGGACCCCAGATAACCCTGG - Intergenic
962991885 3:140585106-140585128 CCTGAGACCCACAAGAACCCTGG + Intergenic
963913214 3:150832716-150832738 CCTGAGCCCCACGACACCCTGGG - Intergenic
968395669 4:234350-234372 CCTCAGTCCCCTGCGACCCCTGG - Intergenic
968585089 4:1412625-1412647 CCTGGGCCCCCAGAGACACCTGG + Intergenic
968593648 4:1471853-1471875 CCCCACACCCCCGAGACACCGGG - Intergenic
971013554 4:22464760-22464782 ACTCAGACCCCCCAGCCCCCTGG - Intronic
975389681 4:73802085-73802107 CCTTAGACCCCTGAGCACCCTGG + Intergenic
975778941 4:77819555-77819577 CGCGGGCCCCCCGAGACCCCGGG - Intronic
978327855 4:107579392-107579414 CCTAAGACTACCGAGCCCCCGGG + Intergenic
981518437 4:145635088-145635110 CCTGAAACCCCCTAGTCCACTGG + Intronic
985555284 5:555119-555141 CCTGCGACCTCGGAAACCCCTGG - Intergenic
985555476 5:555932-555954 CCTGACAGCCCCGGCACCCCGGG - Intergenic
985605762 5:857378-857400 CCACAGACCCCAGAGACCACAGG + Intronic
986143283 5:5051601-5051623 CCTAAGACACCCTAGACCACTGG - Intergenic
992571659 5:78065403-78065425 CCTAAGACCACCGAGCTCCCGGG + Intronic
993900156 5:93579584-93579606 TCCGAGACCCCCCAGCCCCCGGG + Intergenic
997549392 5:134738660-134738682 CCTGAGCCCGCTGGGACCCCCGG - Exonic
998349583 5:141492004-141492026 CCCGGGACCCCCGACACCCGCGG - Intronic
1002160283 5:177310831-177310853 CCTCAGACACCAGAGTCCCCTGG + Intronic
1002443867 5:179277668-179277690 GCTGACACCCCCGAGACCAAAGG + Intronic
1002563489 5:180097746-180097768 CCTGAGCCCCCTGTGTCCCCTGG - Intergenic
1002639101 5:180622223-180622245 CCTGTGGCCCCCCAGCCCCCGGG + Intronic
1002698858 5:181108715-181108737 CCTGAGGCCCTCCAGACCCTGGG + Intergenic
1004774719 6:18830779-18830801 CTTGAGACCACAGAAACCCCAGG + Intergenic
1005703713 6:28430171-28430193 CCTGAGACCCTGGAGGACCCGGG - Intergenic
1006141720 6:31933464-31933486 CCAGAGCCCCCAGAGACCCAGGG - Intronic
1006838589 6:37014113-37014135 CCTCAGCCCCCTGGGACCCCTGG - Intronic
1012401115 6:98843537-98843559 CCTTAGCCCTCCGAGGCCCCTGG + Intergenic
1013116556 6:107107945-107107967 CCTGTGAACCCAGAGACCCGCGG - Intronic
1015137401 6:129889027-129889049 CAAGAGACCACAGAGACCCCTGG + Intergenic
1019143302 6:169961827-169961849 GCTGAGACCCCCGAGAGCACAGG - Intergenic
1019258430 7:66220-66242 CCCGAGTCTCCCCAGACCCCTGG - Intergenic
1019314679 7:379032-379054 CCAGAGACCCCTGCGACCCAGGG - Intergenic
1019327340 7:445007-445029 CCTGAGACCCCCGGAATCCAAGG + Intergenic
1019502200 7:1369909-1369931 GCTGAGACCACTGCGACCCCAGG + Intergenic
1019662561 7:2232817-2232839 CCCGGGACCCCCGGGACCCCGGG + Intronic
1023683441 7:42712192-42712214 CCTGAGAACCCTGGGACCACTGG + Intergenic
1023998306 7:45175372-45175394 CTTGAGGCCCCAGAGAACCCTGG - Intronic
1024490413 7:49975786-49975808 CCTGAGATACTGGAGACCCCAGG - Intronic
1024659086 7:51476111-51476133 TCTGAGACCCCAGAGAAACCCGG + Intergenic
1026128122 7:67597364-67597386 CATGAGACACCAGACACCCCAGG - Intergenic
1026740562 7:72976043-72976065 CCTGTGCGCCCCGAGCCCCCGGG - Intergenic
1026797861 7:73377528-73377550 CCTGTGCGCCCCGAGCCCCCGGG - Intergenic
1026896538 7:74013057-74013079 CCTGAGGCCCCAGAGCCCGCCGG + Intergenic
1026930662 7:74221452-74221474 CCTGGGACCCCTGAGCCACCAGG - Intronic
1026944302 7:74306317-74306339 GCTGGGACCCCCGAGGGCCCTGG + Intronic
1027103170 7:75389028-75389050 CCTGTGCGCCCCGAGCCCCCGGG + Intergenic
1029437316 7:100570459-100570481 CCAGAAGCCCCCGAGGCCCCCGG - Intergenic
1033545807 7:142399164-142399186 CCTGTGACCCTAGAGACTCCAGG + Intergenic
1035378736 7:158424900-158424922 CCTGTGGGCCCCGAGATCCCCGG - Intronic
1035463990 7:159063693-159063715 CCAGATCCCCCCAAGACCCCTGG - Intronic
1035538068 8:407276-407298 CCTGACGCGCCCGAGGCCCCCGG - Intronic
1035828738 8:2672273-2672295 CATGACATCCTCGAGACCCCGGG + Intergenic
1040755264 8:50765462-50765484 ACTAAGAACCCAGAGACCCCAGG - Intronic
1046476404 8:114750220-114750242 CTTGAGACACACGTGACCCCTGG + Intergenic
1049070299 8:140350616-140350638 CAGGAGACCACCGTGACCCCCGG - Intronic
1049092831 8:140529695-140529717 CCTCAGACCCCAGGGAGCCCAGG + Intergenic
1049687480 8:143944704-143944726 CCTGTGACCTCCCACACCCCTGG - Intronic
1049762937 8:144339027-144339049 CCGCAGCCCCCCGGGACCCCTGG + Intergenic
1049854569 8:144853162-144853184 CCGGCGACCCCCGATTCCCCCGG - Intronic
1052855650 9:33404684-33404706 CCTGAGGTCCCTGAGGCCCCAGG + Intergenic
1053174245 9:35910685-35910707 CATGTGACGCCCGAGTCCCCAGG + Intergenic
1055079707 9:72257240-72257262 CCTGATTCCCACGAGGCCCCAGG + Intergenic
1056779032 9:89535687-89535709 TCTGAGCCCCCAGGGACCCCTGG + Intergenic
1057614540 9:96577133-96577155 CCTCAGACTCCCGAGAAACCGGG - Intronic
1058759776 9:108119655-108119677 CCCGAGTCCCCCCAGGCCCCAGG + Intergenic
1061327043 9:129870179-129870201 CCAGAGACCCGCATGACCCCAGG + Intronic
1061372190 9:130203619-130203641 CCCCAGTCCCCTGAGACCCCTGG - Intronic
1061681055 9:132242603-132242625 CCTGCAACCCACCAGACCCCAGG + Exonic
1062188310 9:135230326-135230348 CCTGAGACCCCACAGGCCCCTGG + Intergenic
1062287384 9:135779167-135779189 CCTGAGACCCCCCACAGCCGTGG + Intronic
1062524443 9:136972583-136972605 CCCGGGACCCCCAGGACCCCTGG - Intergenic
1185521314 X:741919-741941 CCTGAGACCCAGGAGAGCCGAGG - Intergenic
1185521342 X:742120-742142 CCTGAGACCCAGGAGAGCCAAGG - Intergenic
1185521375 X:742370-742392 CCTGAGACCCAGGAGAGCCGAGG - Intergenic
1185521394 X:742520-742542 CCTGAGACCCAGGAGAGCCGAGG - Intergenic
1185563002 X:1075056-1075078 CCTGAGACCCAGGAGAGCCGAGG - Intergenic
1185563010 X:1075106-1075128 CCTGAGACCCAGGAGAGCCGAGG - Intergenic
1185563073 X:1075475-1075497 CCTGAGACCCAGGAGAGCCGAGG - Intergenic
1185604843 X:1362675-1362697 CCAGGGACCCCAGAGTCCCCAGG - Intronic
1185660117 X:1720760-1720782 CCTGAGACCCAGGAGAGCCGAGG + Intergenic
1185736887 X:2501597-2501619 GCTGGGACCCCCAAGACCACAGG + Intronic
1185843608 X:3416574-3416596 CCTGAGACCCAGGAGAGCCAAGG + Intergenic
1189019646 X:37320716-37320738 CCTGAGACCACCAAAACCACAGG - Intergenic
1192758517 X:74070667-74070689 CCTGAGACCATGGAGACCCTGGG + Intergenic
1195284663 X:103372219-103372241 CTTGAGACACCGGAGACCCGTGG - Intergenic
1200811224 Y:7487303-7487325 CCTGAGACCCGCGAGAACTGAGG + Intergenic