ID: 1160769067

View in Genome Browser
Species Human (GRCh38)
Location 19:822192-822214
Sequence GGTCGCGTCCTCCTCCCTTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160769055_1160769067 28 Left 1160769055 19:822141-822163 CCGGGGGTCTCGGGGGTCTCAGG 0: 1
1: 0
2: 2
3: 22
4: 258
Right 1160769067 19:822192-822214 GGTCGCGTCCTCCTCCCTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160769067 Original CRISPR GGTCGCGTCCTCCTCCCTTC GGG Intergenic
No off target data available for this crispr