ID: 1160772634

View in Genome Browser
Species Human (GRCh38)
Location 19:839881-839903
Sequence TGGGGCGTACGGCATAAACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160772634_1160772643 11 Left 1160772634 19:839881-839903 CCGGGTTTATGCCGTACGCCCCA No data
Right 1160772643 19:839915-839937 TTCTGGTGTCCGGTGTGAGCAGG No data
1160772634_1160772644 12 Left 1160772634 19:839881-839903 CCGGGTTTATGCCGTACGCCCCA No data
Right 1160772644 19:839916-839938 TCTGGTGTCCGGTGTGAGCAGGG No data
1160772634_1160772642 1 Left 1160772634 19:839881-839903 CCGGGTTTATGCCGTACGCCCCA No data
Right 1160772642 19:839905-839927 CGGGAGTTTATTCTGGTGTCCGG No data
1160772634_1160772646 14 Left 1160772634 19:839881-839903 CCGGGTTTATGCCGTACGCCCCA No data
Right 1160772646 19:839918-839940 TGGTGTCCGGTGTGAGCAGGGGG No data
1160772634_1160772638 -6 Left 1160772634 19:839881-839903 CCGGGTTTATGCCGTACGCCCCA No data
Right 1160772638 19:839898-839920 GCCCCATCGGGAGTTTATTCTGG No data
1160772634_1160772645 13 Left 1160772634 19:839881-839903 CCGGGTTTATGCCGTACGCCCCA No data
Right 1160772645 19:839917-839939 CTGGTGTCCGGTGTGAGCAGGGG No data
1160772634_1160772648 22 Left 1160772634 19:839881-839903 CCGGGTTTATGCCGTACGCCCCA No data
Right 1160772648 19:839926-839948 GGTGTGAGCAGGGGGCAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160772634 Original CRISPR TGGGGCGTACGGCATAAACC CGG (reversed) Intergenic