ID: 1160772842

View in Genome Browser
Species Human (GRCh38)
Location 19:840818-840840
Sequence CAACCTTTGTGGGGGCGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 294}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160772842_1160772855 12 Left 1160772842 19:840818-840840 CCTCCCCGCCCCCACAAAGGTTG 0: 1
1: 0
2: 1
3: 29
4: 294
Right 1160772855 19:840853-840875 CAAAGCCCCCACCTCCTCCCCGG 0: 1
1: 0
2: 3
3: 68
4: 737

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160772842 Original CRISPR CAACCTTTGTGGGGGCGGGG AGG (reversed) Intergenic
900176777 1:1294623-1294645 CACCCTCTGTGGGGAGGGGGCGG + Exonic
900740860 1:4329935-4329957 AAACCCTTGGGGGGGGGGGGTGG + Intergenic
902274497 1:15329523-15329545 TAACCTTTGTTGGGGCTGGAGGG - Exonic
902483048 1:16722040-16722062 CAACAGCTGTGGGGGAGGGGTGG - Intergenic
903681852 1:25102737-25102759 AAACCTCTGTGGGGGTGGGAGGG - Intergenic
904593179 1:31626675-31626697 CTGCCTATGAGGGGGCGGGGAGG - Intronic
905059708 1:35129404-35129426 CCACCTTTGTGTGGGGGGGTTGG + Intergenic
905700209 1:40007140-40007162 CACCCTTTGGGGGGCCGAGGTGG - Intergenic
905700455 1:40009208-40009230 CACCCTTTGGGGGGCCGAGGTGG + Intergenic
906678075 1:47707907-47707929 GAAAGTTTGTGGGGGGGGGGGGG + Intergenic
907148912 1:52263754-52263776 AAACCTGTGGGGGGGGGGGGGGG - Exonic
911124290 1:94326052-94326074 CAAACACTGTGGGGGTGGGGGGG - Intergenic
912880208 1:113404645-113404667 CACTGATTGTGGGGGCGGGGAGG + Intronic
913159135 1:116129432-116129454 CATCCTTTCTGGGGCCAGGGAGG - Intronic
913453210 1:119006935-119006957 CTGCCTTTGTCGGGGCGGGCGGG + Intergenic
914578332 1:148997013-148997035 CAACAGCTGTGGGGGAGGGGTGG + Intronic
914949992 1:152104850-152104872 GAACCTCTGTGGGGGTTGGGAGG + Intergenic
915351259 1:155227750-155227772 CACCCTTAGTGGGTGGGGGGGGG + Intergenic
915567909 1:156726792-156726814 CAACGTTTGTGGAGGGAGGGAGG - Intronic
915953912 1:160207684-160207706 CCAGCTTTGTGGGGGAGGAGGGG - Intronic
916165722 1:161965533-161965555 TAAAGATTGTGGGGGCGGGGTGG - Intergenic
916284466 1:163090210-163090232 CCACTTTTTTGGGGGTGGGGTGG + Intergenic
919926588 1:202194690-202194712 TGGCCTTCGTGGGGGCGGGGGGG + Intronic
922416673 1:225428238-225428260 CACCCTGCCTGGGGGCGGGGAGG + Intronic
922705666 1:227788824-227788846 CCACCTTTGGAGCGGCGGGGAGG - Intergenic
922718150 1:227887460-227887482 CAGCCTTGCTGGGGGAGGGGAGG + Intergenic
923046359 1:230358584-230358606 CATCTTGTGGGGGGGCGGGGAGG - Intronic
923805049 1:237248287-237248309 CATCATTTTTGGGGGGGGGGGGG - Intronic
1064083070 10:12323965-12323987 CCCCCTTTGTGGGGGGGGGGGGG - Intergenic
1064334782 10:14429188-14429210 CTTCCTTTCGGGGGGCGGGGTGG + Intronic
1065549723 10:26858515-26858537 CTTTTTTTGTGGGGGCGGGGTGG - Intronic
1066707089 10:38192381-38192403 CAACCTTTGTGGAGACAGTGTGG + Intergenic
1067379408 10:45759296-45759318 TAACCTTTGTCGGGGGTGGGGGG - Exonic
1067486414 10:46654746-46654768 ACAAGTTTGTGGGGGCGGGGGGG - Intergenic
1067608340 10:47686910-47686932 ACAAGTTTGTGGGGGCGGGGGGG + Intergenic
1067887109 10:50099959-50099981 TAACCTTTGTCGGGGGTGGGGGG - Exonic
1069624122 10:69856955-69856977 CAGCCCTTGTGTGGGCGAGGTGG - Intronic
1069917587 10:71797001-71797023 CATCCTTTGTGGGGATTGGGAGG + Intronic
1070758661 10:79009369-79009391 CGGCCTTTGTTGGGGTGGGGGGG - Intergenic
1071328050 10:84535855-84535877 CCAACTTTGTGGGGGTGGGAAGG + Intergenic
1072809967 10:98453847-98453869 CAAAGGTTGTGGGGGAGGGGAGG + Intergenic
1072968299 10:99993911-99993933 AAAACTTTGTAGGGGAGGGGAGG - Intronic
1075920368 10:126206845-126206867 CATGTGTTGTGGGGGCGGGGGGG + Intronic
1076652904 10:132002257-132002279 CCACCTCTGTGTGGGCAGGGAGG - Intergenic
1077052998 11:576077-576099 CTACGTGCGTGGGGGCGGGGTGG + Intergenic
1077055905 11:592983-593005 CGGCCTTTGTGGGGGAGGGGTGG + Intronic
1077081868 11:727945-727967 CAACCCTAGTGGGAGCGGTGGGG + Intergenic
1077243631 11:1525076-1525098 GCACCTCTGTGAGGGCGGGGCGG - Intergenic
1078090292 11:8260868-8260890 CACCCTTTGGGGGAGCCGGGGGG + Intronic
1078420672 11:11209521-11209543 CAATCCTGGCGGGGGCGGGGGGG + Intergenic
1079423454 11:20316971-20316993 AAAACTGTGTGGGGGTGGGGTGG - Intergenic
1080366739 11:31582880-31582902 CAACTGTGGTGGGGGCGGGGTGG + Intronic
1080459042 11:32437844-32437866 GAATCCTTGTGGGGGCGGGGAGG + Intergenic
1080589415 11:33708459-33708481 GAACTTTTTTGGGGGCGGGGGGG - Intronic
1080964343 11:37196562-37196584 CACCCTTTGTGGAGGCAGTGAGG - Intergenic
1084118547 11:67055954-67055976 CACCCTCTGCGGGGGCGGGGTGG + Intergenic
1084216457 11:67649244-67649266 CAGCCTCTGTGGGGGTTGGGGGG - Intronic
1084553820 11:69864343-69864365 GAACATTTGGGGGGGTGGGGTGG + Intergenic
1084597998 11:70128656-70128678 CAAGCTTGGTGGGGATGGGGCGG - Intronic
1085197347 11:74680607-74680629 GAGCCTGTGTGAGGGCGGGGAGG + Intergenic
1087124361 11:94608318-94608340 CATCCTTTGTGGGGTGGGGAAGG - Intronic
1088916326 11:114230622-114230644 CATCTTCTGTGGGGGGGGGGCGG + Intronic
1089453432 11:118612056-118612078 CAAGTTTGGTGGGGGTGGGGTGG - Intronic
1090040083 11:123283117-123283139 CCATTTTTGTGGGGGGGGGGGGG - Intergenic
1090506496 11:127320784-127320806 CAACCTCTGCTAGGGCGGGGTGG - Intergenic
1091518953 12:1216587-1216609 TAGCCTTGGTGGGGTCGGGGAGG + Intronic
1092944185 12:13437779-13437801 AAAGCTTTGTGGGGGGAGGGGGG + Intergenic
1095589598 12:43888966-43888988 CAACCTTTTTGGCACCGGGGTGG + Intronic
1095622585 12:44275800-44275822 AAAGGCTTGTGGGGGCGGGGAGG + Intronic
1095632875 12:44398603-44398625 CCTCCTGTGTGGGGGTGGGGTGG - Intergenic
1096075229 12:48799987-48800009 CTTCCAGTGTGGGGGCGGGGTGG - Intergenic
1101857123 12:108453087-108453109 GAATCTTTGTGGAGGCTGGGGGG + Intergenic
1102253751 12:111405013-111405035 CAACATGTGGGAGGGCGGGGAGG - Intergenic
1102637157 12:114334433-114334455 TATCCATGGTGGGGGCGGGGAGG + Intergenic
1103527987 12:121580243-121580265 CAGCAGTTGTGGGGGGGGGGAGG + Intronic
1105828920 13:24146863-24146885 CAAAATTGGTGGGGGAGGGGTGG - Intronic
1106516253 13:30456747-30456769 CAGCTTTTGTGGGCGGGGGGGGG + Exonic
1109715640 13:66218653-66218675 CATCTTTTGTGGGGGGTGGGAGG - Intergenic
1113355921 13:109580014-109580036 ACACGTTTGTGGGGGCGGGGAGG + Intergenic
1114337502 14:21707079-21707101 CAACCTTTTTGGAGGGGAGGAGG - Intergenic
1116019366 14:39441977-39441999 CACCCTTTGTTGGCGCCGGGTGG + Intergenic
1116363392 14:44029568-44029590 CAACCTTTGTGGAGGGGAGAGGG - Intergenic
1118030300 14:61812465-61812487 CATCCTCTTTGGGGGAGGGGCGG + Intergenic
1120923373 14:89774705-89774727 TAATTTTTGTGGGGGCAGGGAGG - Intergenic
1121074731 14:91059163-91059185 TATTTTTTGTGGGGGCGGGGTGG - Intronic
1121177037 14:91898329-91898351 AAACCTTTCTGGGGGCTGCGAGG - Intronic
1122307791 14:100776674-100776696 GAACCTGTGTGTGGGCCGGGGGG - Intergenic
1124251884 15:28112286-28112308 CCACCTGTGTGGATGCGGGGCGG + Intronic
1124376158 15:29130112-29130134 CACCCTTTGTGTGGGTGGGAAGG - Intronic
1124483685 15:30098349-30098371 CATGCTTGGTGGGGGGGGGGGGG + Intergenic
1124519894 15:30398877-30398899 CATGCTTGGTGGGGGGGGGGGGG - Intergenic
1124538759 15:30567345-30567367 CATGCTTGGTGGAGGCGGGGGGG + Intergenic
1125887656 15:43240697-43240719 CAGCCTTGGTGGGGGGTGGGTGG + Intronic
1127251956 15:57247985-57248007 CCACCACTGTGGGGGTGGGGTGG - Intronic
1128224684 15:65993636-65993658 CAGGCTGTGTGGGGGCGGGTAGG + Intronic
1129780713 15:78268892-78268914 CAGCAGTTGTGGGGGCTGGGAGG + Intronic
1129955642 15:79634395-79634417 CAACATTTGGGAGGGCAGGGTGG + Intergenic
1131780404 15:95850450-95850472 CAACTTTTGTGGGAGCTTGGAGG + Intergenic
1132420170 15:101659037-101659059 CAACCTTTGGGAGGCCGAGGTGG - Intronic
1132580781 16:683776-683798 GAACCTCTGCGGGGGCGGGGAGG + Exonic
1134510847 16:14845692-14845714 CTACCTTTGCGGTGACGGGGAGG + Intronic
1134698488 16:16244179-16244201 CTACCTTTGCGGTGACGGGGAGG + Intronic
1134852531 16:17492373-17492395 GAACCGTTGTGGGTGGGGGGCGG - Intergenic
1134973346 16:18550499-18550521 CTACCTTTGCGGTGACGGGGAGG - Intronic
1135764989 16:25169903-25169925 CTACTTATATGGGGGCGGGGTGG - Intronic
1137921942 16:52498573-52498595 GAACCTTTGTGGGGTTGGGGGGG + Intronic
1138466366 16:57194558-57194580 TAGCCTTTGTGGGGGAGGGTTGG + Intronic
1139780603 16:69348446-69348468 CTCCCTTTGTGTGTGCGGGGGGG + Intronic
1139852393 16:69959155-69959177 CACCCTTGGTGGGAGAGGGGAGG + Intronic
1139881364 16:70182063-70182085 CACCCTTGGTGGGAGAGGGGAGG + Intronic
1140371143 16:74413441-74413463 CACCCTTGGTGGGAGAGGGGAGG - Intronic
1141179375 16:81742139-81742161 TTACCATTGTGGGGGCGGGGGGG + Intronic
1141186138 16:81788887-81788909 CACCCCTTGTGGGGGAAGGGAGG - Intronic
1141514277 16:84533026-84533048 CAACCCTTCTTGGGGAGGGGAGG - Intronic
1141516107 16:84546225-84546247 CATCCTTTGTGGTTGGGGGGGGG + Intronic
1142361324 16:89628793-89628815 AAAGGTTTGTGGGGGAGGGGGGG + Intronic
1143978199 17:10845803-10845825 CTAATTTTGTGGGGGCGGGGGGG - Intergenic
1144164910 17:12601221-12601243 CCACATTGGTGGGGGTGGGGCGG - Intergenic
1144696197 17:17305401-17305423 CCACGTGTGTGGGGGCGGGGGGG - Intronic
1145978216 17:28996448-28996470 AAACCTGAGTGGGGGAGGGGAGG + Intronic
1147040404 17:37713867-37713889 CATCTTATGAGGGGGCGGGGTGG + Intronic
1147178456 17:38671120-38671142 CAACCTGGAAGGGGGCGGGGTGG - Intergenic
1147184057 17:38704298-38704320 CAACCTGTGTGGGCAAGGGGGGG - Intergenic
1147733637 17:42619916-42619938 GAAGATTTCTGGGGGCGGGGGGG - Intergenic
1148116338 17:45177564-45177586 CAGCCTTCGTGGGGGCTGGGAGG + Intergenic
1148158315 17:45436052-45436074 CTACCTTTCTGAGGGAGGGGAGG + Exonic
1148777780 17:50105352-50105374 ATACCTGTGTGGGGGCGGGAGGG - Exonic
1148786254 17:50147642-50147664 CAAAATTAGTGGGGGTGGGGTGG + Intronic
1150415735 17:64987212-64987234 CAACCTTTTTGGGGCTGAGGTGG + Intergenic
1150980347 17:70134293-70134315 GAACCTTTTTGGGGGGAGGGTGG + Exonic
1151596117 17:75078840-75078862 GAAGGTTGGTGGGGGCGGGGGGG + Intergenic
1152409481 17:80115880-80115902 CAGCCTTTGCTGGGGCGAGGTGG + Intergenic
1152438008 17:80288039-80288061 CAACCTCGGTGGGCGCGGAGAGG - Exonic
1152453491 17:80398605-80398627 CAACCACTGTTGGGGCGGGCGGG - Exonic
1152617865 17:81346099-81346121 CTTCCCTCGTGGGGGCGGGGCGG - Intergenic
1152758742 17:82097792-82097814 GCGCCTTTGTGGGCGCGGGGAGG + Intronic
1152780592 17:82226004-82226026 CAACCTTTGTGGGAGGGGGGCGG - Intergenic
1153387112 18:4510677-4510699 CAACCTTCGTGGTGGTGTGGTGG + Intergenic
1156440642 18:37183947-37183969 CATCCTTTGTGGGGCAGGAGAGG - Intronic
1159615617 18:70575964-70575986 CTACCTTTGTTGGGGGTGGGTGG + Intergenic
1160772842 19:840818-840840 CAACCTTTGTGGGGGCGGGGAGG - Intergenic
1160902419 19:1435005-1435027 CAACCTTGGGGGGGGGGGCGGGG + Exonic
1161770939 19:6230386-6230408 CAACCTGTGCCGGGGCGTGGTGG - Intronic
1163302829 19:16458444-16458466 CAAGCGGGGTGGGGGCGGGGCGG - Intronic
1163492202 19:17623552-17623574 CATCCGTGATGGGGGCGGGGCGG + Intronic
1164121776 19:22272314-22272336 CAACCACTGTGGGGTGGGGGGGG + Intergenic
1164217539 19:23162979-23163001 CAACCACTGTGGGGGTAGGGTGG + Intergenic
1165078233 19:33292520-33292542 CATCCTTTGTGGGGGGGAGGGGG + Intergenic
1166084858 19:40467614-40467636 CAGCCTTTGCGGGGGGGGGGGGG + Intronic
1167292233 19:48630650-48630672 CCTCCCTTGCGGGGGCGGGGAGG - Exonic
1167306927 19:48714839-48714861 CAACTTGTGTGGGGGGGGCGAGG + Exonic
1167377238 19:49118786-49118808 CGGCCTCTGTGTGGGCGGGGCGG + Exonic
1168406425 19:56112829-56112851 CTGCCTTTGTGGGGCGGGGGAGG + Intronic
925064992 2:922577-922599 CAATCTCTGTGGGGCAGGGGAGG - Intergenic
925159885 2:1676520-1676542 CAACCTGAGTGGGTGCGGGAGGG - Intronic
931430995 2:62208943-62208965 CAACCTGGGTGGGGGCAGTGGGG + Intronic
931887650 2:66634413-66634435 CAACCTTTGGCCGGGCGCGGTGG + Intergenic
932542961 2:72675808-72675830 AAAAGTTGGTGGGGGCGGGGGGG + Intronic
932593211 2:73079536-73079558 CATCCTTTGTGGGGCAGGTGAGG - Intronic
935083516 2:99822689-99822711 CAAACTGTGTGGATGCGGGGAGG - Intronic
935646846 2:105344279-105344301 CTACCTTTGTGGGAGAGAGGAGG + Intronic
939022281 2:136972834-136972856 AAACCTTTTTGGGGGTGTGGGGG + Intronic
940353236 2:152712252-152712274 TAAAATTTGTGGGGGCAGGGGGG + Intronic
941060572 2:160842522-160842544 CAACCTATGTGGAGGGGCGGGGG - Intergenic
941262912 2:163319570-163319592 CTTCATTTGTGGGGGTGGGGAGG - Intergenic
941573444 2:167200429-167200451 GAACCATTAAGGGGGCGGGGTGG + Intronic
941886525 2:170533410-170533432 TATCTTTTGTGGGGGTGGGGGGG + Intronic
944106008 2:196080176-196080198 GCACCTTTATGGGGGTGGGGAGG - Intergenic
944215609 2:197252335-197252357 AGACCTTTGGCGGGGCGGGGCGG - Intronic
948610063 2:239161359-239161381 CAACCTTGATGGGGAGGGGGAGG - Intronic
949023190 2:241752815-241752837 CTTCCTTTGTGGGGGCATGGGGG - Intronic
1170454058 20:16516271-16516293 CAAGCTGTGTGGGGCTGGGGTGG + Intronic
1170849816 20:19994628-19994650 CAATCTTTGTGGGGGTGGAGGGG - Intronic
1172195755 20:33090436-33090458 CTACGTTGGTGGGGGCAGGGGGG - Intronic
1173015293 20:39220092-39220114 GAAGCTGTGTGGGGGCGGGGAGG - Intergenic
1173717049 20:45217541-45217563 TGACCTTGGTGGGGGCAGGGGGG + Intergenic
1173840152 20:46151877-46151899 CAACCTTGGTGGGGCCTCGGCGG + Intergenic
1174044986 20:47727049-47727071 CAGCCTTTATGGGGGGGGGCGGG + Intronic
1178400298 21:32279471-32279493 CAACCTTTTTTGGGGGGTGGGGG + Intergenic
1180229769 21:46420095-46420117 CAACCTTTGAGGGGCCTGCGCGG + Intronic
1180633378 22:17245076-17245098 CAACATTTGTTGGGGTGGAGTGG + Intergenic
1180744615 22:18078935-18078957 CAACCTTGGGCGGGGCGGGGAGG - Intronic
1181399061 22:22640260-22640282 CAACCTTTGAGAGGCCGAGGCGG - Intergenic
1181478645 22:23183539-23183561 GTCCCTATGTGGGGGCGGGGTGG + Intronic
1181568069 22:23751599-23751621 CTATTTCTGTGGGGGCGGGGAGG - Intergenic
1181650360 22:24255799-24255821 CAACCTTTGAGAGGCCGAGGCGG + Intergenic
1182024683 22:27108872-27108894 CAGCCAGGGTGGGGGCGGGGGGG - Intergenic
1182932821 22:34191329-34191351 CATCCTTTTTGGGGGAGGTGGGG - Intergenic
1183076047 22:35427698-35427720 AAACATTTGTGGGGGGTGGGGGG - Intergenic
1184417984 22:44363284-44363306 CCGGCTTTGTGGGGGCAGGGAGG + Intergenic
949516172 3:4808858-4808880 CAGTCTTTGTGGGGGAGGGGGGG - Intronic
949995331 3:9612100-9612122 TAACATTTGTGTGGGGGGGGGGG + Intergenic
950186705 3:10949879-10949901 CACCCTTGGTAGGGGCGGGATGG + Intergenic
951208197 3:19946748-19946770 CAGCCCTTGTGGGAGCGGCGAGG - Intronic
951679541 3:25280601-25280623 CCATCTTTGTGGGGGTGGGTGGG - Intronic
951957904 3:28277489-28277511 GAACTTTAGTGGGGGAGGGGAGG + Intronic
952597228 3:35032619-35032641 CAACCCTTGTGGGGTCAGTGTGG - Intergenic
952833898 3:37588410-37588432 CAGCCTCTGTGGGGAGGGGGTGG - Intronic
953660927 3:44891002-44891024 CTGCCTTCGTGGGGGTGGGGAGG + Intronic
954592807 3:51798268-51798290 CAACCTTTGGCTGGGCGTGGTGG - Intergenic
954781266 3:53063091-53063113 CCACCCTGGTGGAGGCGGGGCGG + Intronic
955347599 3:58172637-58172659 CTCCTTTTGTGGGGGTGGGGTGG + Intergenic
955828871 3:62980184-62980206 CAACATTTTTGGGGGCTGAGTGG - Intergenic
959569594 3:107868549-107868571 CAAGCCTTATGGGGGAGGGGAGG + Intergenic
960745154 3:120879567-120879589 CAGTGTGTGTGGGGGCGGGGTGG + Intergenic
960845439 3:122000479-122000501 CAAGGTATGTGGGAGCGGGGAGG - Intronic
961634905 3:128327288-128327310 CAACCTTGGGGGGGGGGGGATGG - Intronic
961818079 3:129561509-129561531 CCTCCTTGGTGGGGGCTGGGCGG - Intronic
962657543 3:137563474-137563496 GTACCTTTGTTGGGGGGGGGGGG - Intergenic
962902713 3:139775162-139775184 GAAAGGTTGTGGGGGCGGGGTGG + Intergenic
967096745 3:186183494-186183516 GAACCTTTCTTGGGGGGGGGCGG + Intronic
967469267 3:189843346-189843368 CAACATTTGTGGGCGCGGCCCGG + Intronic
969528771 4:7718030-7718052 CAACGTGTGTGAGGGTGGGGTGG + Exonic
970262620 4:14244223-14244245 GAATCATGGTGGGGGCGGGGAGG - Intergenic
972786357 4:42330069-42330091 TAACCTTTGTGTGGGAGGGAGGG - Intergenic
973655674 4:53044912-53044934 CAAGTTTTTTGTGGGCGGGGGGG - Intronic
973797241 4:54440070-54440092 CAATGTGTGTGGGGGGGGGGGGG + Intergenic
974897037 4:67952568-67952590 GAACCTCTGTGGGGATGGGGAGG - Intronic
975484170 4:74916032-74916054 CAAGCTTGGTGGGGGCAGGAGGG - Intergenic
978184758 4:105843997-105844019 CTACCTTTGTGGGCCTGGGGAGG - Intronic
981328269 4:143477360-143477382 CAGCCTTTCTGGGGGCTGGTTGG - Intergenic
981354676 4:143774483-143774505 CAACCTTGGTGGGAGCTGAGGGG + Intergenic
986633761 5:9800413-9800435 CAGCCTTTGTGGTGGGAGGGAGG + Intergenic
986859216 5:11905571-11905593 CAAGCTCTGCGGGGGTGGGGGGG - Intergenic
987035800 5:14017199-14017221 CAACCTTACTGGAGGAGGGGTGG + Intergenic
988170044 5:27641693-27641715 TATTTTTTGTGGGGGCGGGGTGG - Intergenic
989194174 5:38699933-38699955 CAAGCTTGGTGGGGGTAGGGGGG + Intergenic
991459469 5:66842450-66842472 CAACATTTGGCGGGGCGGGAGGG - Intronic
992078864 5:73215985-73216007 CAGCCTTAGATGGGGCGGGGGGG + Intergenic
993962618 5:94318912-94318934 CAAGCTTTGTGGGGACAAGGAGG - Intronic
997717538 5:136053173-136053195 CATCCTTTGTGGCGGGGGAGGGG + Intronic
997817762 5:137034953-137034975 CAGCCTTGGTGGGGGTGGGAGGG + Intronic
998007123 5:138664508-138664530 CACCTTGTGTGGGGGAGGGGTGG - Intronic
998823371 5:146076893-146076915 CATTCTTTGTGGGGGTGGTGTGG - Intronic
999906184 5:156143448-156143470 CAACCATTCTGGGGGCTGGAGGG - Intronic
1000071069 5:157741625-157741647 AAACCTTTCTGGGGGCTGGGAGG - Intergenic
1000478140 5:161737878-161737900 CAACTTTTGTGGGGGAGGATAGG - Intergenic
1001012787 5:168113605-168113627 AGAACTTTGTGGGGGCTGGGAGG + Intronic
1003098252 6:3158074-3158096 CGCCGTTTGTGGGGGTGGGGTGG + Intergenic
1003843402 6:10146732-10146754 CTACCTTTGCGGGGGGTGGGTGG - Intronic
1004413740 6:15405637-15405659 AAACCTTTGTTGGGGAGAGGAGG - Intronic
1006300994 6:33193423-33193445 CAAGCTTTGTCGGGGAGGGGGGG - Intergenic
1006638998 6:35479454-35479476 CTCCCTCTGTGGGGACGGGGAGG - Intronic
1007790950 6:44307845-44307867 CATCTTTTGTGGGGGTGGGCAGG + Intronic
1008355389 6:50546899-50546921 TAACCTTTCTGGGGAAGGGGTGG - Intergenic
1010134922 6:72540427-72540449 CAAGTCTTGTGGGGGTGGGGGGG - Intergenic
1010303088 6:74283994-74284016 CAATCTTTTTTGTGGCGGGGAGG - Intergenic
1011965890 6:93156907-93156929 CAGGCTGTGTGGGGGTGGGGTGG - Intergenic
1014586330 6:123202230-123202252 CCACCACGGTGGGGGCGGGGGGG - Intergenic
1016422205 6:143897258-143897280 CACCCTTCCTGGGGTCGGGGCGG + Intronic
1017447359 6:154518793-154518815 GAACCTGTGGGGGGGTGGGGTGG - Intergenic
1017478725 6:154827814-154827836 ACACCTTTTTTGGGGCGGGGCGG + Intronic
1017525742 6:155240128-155240150 CAACCATTGAGGGGACTGGGTGG + Intronic
1017746129 6:157448124-157448146 CAACCTTTGGGAGGCTGGGGTGG - Intronic
1018092875 6:160360764-160360786 CTACATTGGTTGGGGCGGGGGGG - Intronic
1018880256 6:167871113-167871135 CAATCTGTTGGGGGGCGGGGCGG - Intronic
1018971484 6:168532432-168532454 AAATCTTTGTGGGGGAGGGGGGG - Intronic
1019804482 7:3113162-3113184 TATCCTTTGTTGGGGGGGGGTGG + Intergenic
1020022855 7:4879321-4879343 GAACCTCTGTGGGGGCAGGAGGG + Intronic
1020444981 7:8259619-8259641 CCACCTTTTTAGGGGCAGGGTGG - Intronic
1021158768 7:17245670-17245692 GAACCTTAGTGGGGGCTGAGAGG + Intergenic
1021710139 7:23407930-23407952 CAACATTTGTGGGGGGCAGGGGG + Intronic
1023724838 7:43132167-43132189 AAACCTTACTTGGGGCGGGGGGG - Intronic
1024165327 7:46724240-46724262 CAACCGTAGTGGTGGAGGGGTGG - Intronic
1024577686 7:50778130-50778152 CAAATTTTGGGGGGTCGGGGTGG - Intronic
1025069208 7:55884310-55884332 CAACCTTTGTGGGTTTGGAGAGG - Intergenic
1025089793 7:56052254-56052276 CAATCTCTGCGGGGACGGGGTGG + Intronic
1025819329 7:64947684-64947706 CACCCTGTGTGGGGGCGGAGGGG + Intergenic
1025901948 7:65751545-65751567 CAATCTCTGCGGGGACGGGGTGG + Intergenic
1027264788 7:76488363-76488385 CATCTCTGGTGGGGGCGGGGCGG + Intronic
1027316159 7:76986465-76986487 CATCTCTGGTGGGGGCGGGGCGG + Intergenic
1027683838 7:81256420-81256442 CAACCTTAGTGGTGGCTGGCAGG - Intergenic
1027702190 7:81483465-81483487 CCAACTTCGTGGTGGCGGGGGGG - Intergenic
1029641216 7:101821248-101821270 GAATTTTTTTGGGGGCGGGGGGG - Intronic
1029977829 7:104850784-104850806 AAACCTTGGCGGGGGTGGGGGGG - Intronic
1030097602 7:105914786-105914808 CTTCCATTGTGGGGGCGGGGCGG + Intronic
1030107916 7:106002141-106002163 TCACCTTTGTGGGGGATGGGTGG + Intronic
1030401347 7:109054590-109054612 CAAGAGTTGTGGGGGGGGGGGGG + Intergenic
1033793694 7:144822375-144822397 GAACTTTTGTGGGGGTGGGAGGG + Intronic
1034121760 7:148634663-148634685 AAACGGTTGTGGCGGCGGGGGGG - Intergenic
1034681358 7:152930930-152930952 CATCTTATGTGGGGGGGGGGCGG + Intergenic
1035436504 7:158863770-158863792 CTCCCGGTGTGGGGGCGGGGGGG + Intronic
1037244139 8:16812352-16812374 AAACATTCCTGGGGGCGGGGGGG + Intergenic
1037392316 8:18406421-18406443 AAAACTTTGCAGGGGCGGGGTGG + Intergenic
1038699873 8:29839982-29840004 CACCCTTTGTGCGGGTGAGGAGG - Intergenic
1040568442 8:48587457-48587479 CAACCCTGGTGGGGGCTGTGAGG + Intergenic
1041137199 8:54772969-54772991 CAACCTTTGTGGGGACAGGTTGG + Intergenic
1042129892 8:65578074-65578096 CAACCTTTGGGAGGCCGAGGTGG - Intergenic
1044710970 8:95057433-95057455 CTACATTTGGGGGGTCGGGGTGG + Intronic
1044728687 8:95213435-95213457 CATATTTGGTGGGGGCGGGGGGG - Intergenic
1044758188 8:95488994-95489016 CGAACTCTGTGGGGGAGGGGAGG + Intergenic
1047757523 8:127930132-127930154 CAACCTCTGGTGGGGCGGTGCGG + Intergenic
1049287998 8:141786975-141786997 CAGCCATTGTGGGAGCTGGGGGG - Intergenic
1050160243 9:2711372-2711394 CAAGCTTTGGTGGGGGGGGGGGG + Intergenic
1057002155 9:91519909-91519931 CAACCCTTGAGGTGGCGTGGGGG + Intergenic
1057724532 9:97558868-97558890 CTTCCTTTTTGGGGGCTGGGGGG - Intronic
1058189434 9:101894577-101894599 CAACTTATGTGGGGGGGGAGGGG + Intergenic
1059196991 9:112379875-112379897 CGACCAGTGAGGGGGCGGGGCGG + Intergenic
1060105115 9:120868767-120868789 CACCCTGTGGAGGGGCGGGGTGG - Intronic
1060507963 9:124212593-124212615 CAGCGTTTGTGGGGGTGGAGAGG - Intergenic
1060664576 9:125425050-125425072 CAGATTTGGTGGGGGCGGGGGGG - Intergenic
1061244372 9:129393996-129394018 CAAGCTCTGTGAGGCCGGGGAGG + Intergenic
1061371542 9:130200517-130200539 CCACCTATGTGGGGGGGTGGGGG - Intronic
1062436054 9:136547024-136547046 CACCCTGTGTTGGGGTGGGGAGG - Intergenic
1187009649 X:15266615-15266637 CAACCCTGGTGGGGTCAGGGTGG - Intronic
1187461068 X:19487114-19487136 CAACATTTCTGGGGGTGGGGGGG + Intronic
1187483133 X:19676346-19676368 CTACCTGGGTGGGGGCTGGGTGG + Intronic
1190200717 X:48358253-48358275 AAATATTAGTGGGGGCGGGGTGG - Intergenic
1190667535 X:52708693-52708715 AAATATTAGTGGGGGCGGGGTGG - Intergenic
1190671883 X:52749715-52749737 AAATATTAGTGGGGGCGGGGTGG + Intergenic
1190708933 X:53051307-53051329 CCATCTCTGTGGGGGCAGGGAGG + Intronic
1192559340 X:72115416-72115438 GAAGTTTGGTGGGGGCGGGGGGG + Intergenic
1193679554 X:84501885-84501907 GCACCTTGGTGGGGGCGGGGTGG - Intronic
1194174497 X:90629504-90629526 CAAGCACAGTGGGGGCGGGGAGG - Intergenic
1194337459 X:92665692-92665714 CAGCCTTTTTGGGGGTAGGGAGG - Intergenic
1194667803 X:96694911-96694933 CAACCAAAGTGGGGGTGGGGAGG - Intronic
1194974527 X:100380183-100380205 CCACCTTGGTGGGGGAGGGGTGG + Intronic
1197147201 X:123183959-123183981 CATCTTTTGCGGGGGGGGGGGGG + Intergenic
1197745707 X:129931577-129931599 GAACCCTGTTGGGGGCGGGGGGG - Intergenic
1198795526 X:140390457-140390479 CCACCATTTTGGGGGCAGGGGGG - Intergenic
1200249816 X:154546952-154546974 CACCCCTCGTGCGGGCGGGGCGG + Exonic
1200520712 Y:4207197-4207219 CAAGCACAGTGGGGGCGGGGAGG - Intergenic
1201172822 Y:11285748-11285770 GAACCGTTGTGGGGGGGGGGAGG + Intergenic
1201416892 Y:13755846-13755868 CACCATTTTTGGGGGAGGGGAGG + Intergenic
1201514129 Y:14799010-14799032 CATCCTTTCTGGGGGCATGGAGG + Intronic