ID: 1160773407

View in Genome Browser
Species Human (GRCh38)
Location 19:843804-843826
Sequence CTGGGGCTGCACCGCGGCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 291}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160773398_1160773407 4 Left 1160773398 19:843777-843799 CCGGGGCAGGGTCGCCGAGGGAG 0: 1
1: 0
2: 1
3: 20
4: 223
Right 1160773407 19:843804-843826 CTGGGGCTGCACCGCGGCCTCGG 0: 1
1: 0
2: 3
3: 32
4: 291
1160773405_1160773407 -10 Left 1160773405 19:843791-843813 CCGAGGGAGGGGTCTGGGGCTGC 0: 1
1: 1
2: 6
3: 64
4: 541
Right 1160773407 19:843804-843826 CTGGGGCTGCACCGCGGCCTCGG 0: 1
1: 0
2: 3
3: 32
4: 291
1160773397_1160773407 5 Left 1160773397 19:843776-843798 CCCGGGGCAGGGTCGCCGAGGGA 0: 1
1: 0
2: 0
3: 18
4: 210
Right 1160773407 19:843804-843826 CTGGGGCTGCACCGCGGCCTCGG 0: 1
1: 0
2: 3
3: 32
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160773407 Original CRISPR CTGGGGCTGCACCGCGGCCT CGG Intronic
900082108 1:866267-866289 CTGGTGCTGCAGCACGGCCTTGG + Intergenic
900092100 1:925038-925060 CTGGAGCTGCAGCGCCCCCTCGG - Intronic
900401087 1:2473246-2473268 CTGGGCCTGCCCCCCGACCTTGG - Intronic
900671398 1:3857094-3857116 CTTGGGGTGCAAGGCGGCCTGGG - Exonic
900787028 1:4655616-4655638 CTGGAGCAGCACCGCGGCCCTGG + Intronic
900814555 1:4833445-4833467 CTGGGGCTGCACAGCTGCTGTGG - Intergenic
901217549 1:7563146-7563168 ATGGGGCTGCCCCGATGCCTGGG - Intronic
901380121 1:8867596-8867618 CTGCCGCTGCACTGCAGCCTGGG - Intronic
901640200 1:10689176-10689198 CTGGGGCTGCACCACTGACCTGG + Intronic
902873666 1:19328595-19328617 CAGGCGCAGCACCGCCGCCTCGG + Exonic
904389217 1:30170072-30170094 CAGGGGCAGCAGCGTGGCCTGGG - Intergenic
904841192 1:33372980-33373002 CTGGGGCTGCAAGGCAGACTTGG + Intronic
905757265 1:40521574-40521596 CTGGGACTGCACTCCAGCCTGGG - Intergenic
905867029 1:41382123-41382145 CTGGGCCTGCACGGCGGCGGCGG + Exonic
907039982 1:51250780-51250802 CTGGGGCTGCACTGCCACCCTGG - Intronic
907237676 1:53062865-53062887 CTGGGGCGGCACAGTGGCCGGGG - Intronic
907489626 1:54800735-54800757 CTGGGGGTCCCCGGCGGCCTCGG + Exonic
912418627 1:109528834-109528856 CAGGGGCTGGACCTGGGCCTGGG + Intergenic
914919552 1:151838235-151838257 CCGGGGCGGGACCGCGGCCGGGG + Exonic
915086504 1:153392708-153392730 CTGGGGATCCACCGTGCCCTGGG + Intergenic
915645082 1:157264785-157264807 CTGGGGCTGATCAGAGGCCTAGG + Intergenic
915764754 1:158351461-158351483 CTGTGGCTGCACTGCAGCCTGGG + Intergenic
915937759 1:160098917-160098939 CTGGGGCTGGGCCGAGGCCCGGG - Intronic
918421946 1:184373160-184373182 CTTAGGCTGCACAGCAGCCTGGG - Intergenic
920655107 1:207868869-207868891 CCCCGGCTGCAGCGCGGCCTTGG - Intergenic
921317143 1:213903203-213903225 CTGGGGCTGGGCAGGGGCCTGGG + Intergenic
922250506 1:223845577-223845599 CGGGGGCTGGTCCGCGCCCTCGG - Intronic
922886594 1:229025203-229025225 CAGGGTCTGCACCGTGGGCTTGG - Intergenic
923539619 1:234878512-234878534 CGGGGGCTGCTCCGTGGCCTTGG - Intergenic
924527424 1:244864381-244864403 CTGCGGCTGCTCCTCGGCCCGGG + Exonic
1062874581 10:932832-932854 CCGGGGCTGAGCCGAGGCCTTGG - Intergenic
1065944593 10:30595056-30595078 CTGAGGCTTCACTGCAGCCTGGG - Intergenic
1066697840 10:38094522-38094544 CTGGGGGTTCCGCGCGGCCTGGG + Intronic
1067478019 10:46578966-46578988 CTGGGGCGGGACTGCGGCCTCGG + Intronic
1067524373 10:47029332-47029354 CTGGGGCTGCACAGAGGCTGTGG - Intergenic
1067616721 10:47762821-47762843 CTGGGGCGGGACTGCGGCCTCGG - Intergenic
1067737664 10:48870883-48870905 CTGGGGATGCACAGCTCCCTGGG - Intronic
1069044115 10:63724275-63724297 ATGGGGCTGCACCTCACCCTCGG + Intergenic
1069679957 10:70277401-70277423 CTGGGGCTGCCCACCAGCCTGGG - Intronic
1069939891 10:71948178-71948200 CTGGAGCTGAACCCTGGCCTGGG - Intergenic
1070327390 10:75397413-75397435 CTGGGCCTGGGCCGGGGCCTCGG - Intergenic
1072257133 10:93631150-93631172 CTGGGGCCTCCCCGGGGCCTTGG + Intronic
1074884324 10:117682959-117682981 CTGGGGGTGGACCCTGGCCTCGG + Intergenic
1075107399 10:119550172-119550194 CTGGCACTGCACCCCAGCCTGGG - Intergenic
1075621716 10:123933124-123933146 ATGGGGCTCCACCATGGCCTGGG + Intronic
1075811201 10:125226423-125226445 CTCGGGCTGCACAGCCTCCTTGG + Intergenic
1076010450 10:126983943-126983965 CTGGAGCTCCACTGCAGCCTTGG + Intronic
1076096181 10:127736620-127736642 CTGGGCCTGGACAGCGGCCCTGG - Intergenic
1076244330 10:128934235-128934257 CTGAGGCTGCTCCCCGGCCCAGG - Intergenic
1076248005 10:128962375-128962397 ATGGGGCTGCTCAGGGGCCTGGG + Intergenic
1076396915 10:130145842-130145864 CTGGAGCTGCACTCCAGCCTGGG - Intronic
1076567292 10:131407386-131407408 CTGGGGCTGTGCCGTTGCCTGGG - Intergenic
1076748061 10:132524321-132524343 CTGGGGCTGCACTGGTCCCTAGG - Intergenic
1076782192 10:132730475-132730497 GTGGGGCTGCAGAGCGGCCGAGG - Intronic
1076798123 10:132808627-132808649 CTGAGGCTGCACCAAGGGCTGGG + Exonic
1077229102 11:1450683-1450705 CTGGGGCTGGACGGGGGCGTGGG - Exonic
1077298588 11:1837271-1837293 CAGGGGCTGCCCCGAGGCCCGGG - Exonic
1080037294 11:27722637-27722659 CGGGGGCTGCCCCGCCGCCGGGG + Intergenic
1082786540 11:57320389-57320411 CTGGGGCTGCACATCGAGCTGGG + Exonic
1082975562 11:59067871-59067893 GTGGGGCTGCACTACAGCCTGGG - Intergenic
1083778487 11:64906245-64906267 CTGGGGCCTCACCGCGCACTGGG + Intronic
1084570717 11:69958149-69958171 TTGGGGCTGCAGTGTGGCCTGGG - Intergenic
1084578974 11:70010613-70010635 CAGGGGCTGCAGAGAGGCCTGGG + Intergenic
1087328670 11:96753468-96753490 CTGGGGCTGCCCCTCTTCCTGGG + Intergenic
1088645343 11:111912786-111912808 TTGGGGCTGCACCTCGGACCAGG + Exonic
1090788638 11:130070509-130070531 CTCGCGCGGCACCGGGGCCTCGG + Intronic
1091319741 11:134640976-134640998 TGGGGGCTGCACAGAGGCCTGGG - Intergenic
1091497850 12:988013-988035 GTGGTGCTGCACCCCAGCCTGGG - Intronic
1092134420 12:6136684-6136706 CTGGGGCTCCTCCTCGCCCTGGG - Intergenic
1096148063 12:49293063-49293085 CTGGGGCTGCAGCTGGGCCTGGG - Intergenic
1096495312 12:52036601-52036623 CGGGGCCTGCACCCCCGCCTCGG + Intronic
1100641280 12:96484381-96484403 GTGGGGCTGCTTAGCGGCCTGGG - Intergenic
1102482295 12:113232261-113232283 CTGAGGCTGCACTGTGTCCTAGG - Intronic
1102677541 12:114668800-114668822 CTGGGGCTCCCCCGAGGACTGGG - Intergenic
1105851263 13:24338843-24338865 CTGGGGCTGCCCCTAGGCCGGGG + Intergenic
1106015220 13:25863088-25863110 CTGGGCCTGCACAGCTTCCTTGG - Intronic
1106246534 13:27954528-27954550 CTGGGTCTGCGCCGCTGCCCGGG - Intergenic
1106316317 13:28597107-28597129 CTGCCGCTGCACCCCAGCCTGGG - Intergenic
1107595906 13:41962688-41962710 CTGCCGCTGCACCCCAGCCTGGG - Intergenic
1109711395 13:66165196-66165218 GTCGGGCTGCTCAGCGGCCTGGG + Intergenic
1112572763 13:100608562-100608584 CTGGGCCTGTACCTGGGCCTGGG + Intronic
1112602801 13:100873194-100873216 CAGGGCCTGCACACCGGCCTTGG - Intergenic
1114525535 14:23365338-23365360 CCGGGGCGCCCCCGCGGCCTAGG - Exonic
1114636269 14:24188621-24188643 CTGGAGCTGTTCCGTGGCCTGGG + Exonic
1115761973 14:36584029-36584051 CCGGAGCTGCACCGCGCGCTGGG + Intergenic
1117337391 14:54766952-54766974 CTGGGGCTGCACGGAGGTCAAGG - Intronic
1118610163 14:67533432-67533454 CTGGGGCTGCGCCGCGGCGGAGG + Intronic
1121235591 14:92389485-92389507 CAGGGGCTGCACCCTGGCCCAGG - Intronic
1122854916 14:104555334-104555356 CTGGGGCTGCCCCGTGCCCTGGG - Intronic
1123006187 14:105324955-105324977 CTGGGGGTGCACACGGGCCTGGG + Intronic
1123068188 14:105628557-105628579 CTGGGGCTGCTCCACAGCATAGG - Intergenic
1123072195 14:105647336-105647358 CTGGGGCTGCTCCACAGCATAGG - Intergenic
1123092202 14:105746853-105746875 CTGGGGCTGCTCCACAGCATAGG - Intergenic
1123097776 14:105774554-105774576 CTGGGGCTGCTCCACAGCATAGG - Intergenic
1124343507 15:28905078-28905100 CTGGGACTGCACAGGTGCCTGGG + Intronic
1129234319 15:74214528-74214550 CTGGTGCTGCCCTGCGGCCCTGG + Intergenic
1130115618 15:81002151-81002173 CGGGGAAGGCACCGCGGCCTTGG + Exonic
1131007099 15:88987210-88987232 CTGGGCCTGCACTGCAGGCTGGG + Intergenic
1131977527 15:97961086-97961108 CTCGGCCAGCACCGCGGCCCTGG + Exonic
1132053002 15:98625943-98625965 CTGCAGCTGCACTGCAGCCTGGG + Intergenic
1132395557 15:101471097-101471119 CTGGGGCTGAAACTCTGCCTGGG + Intronic
1132755000 16:1479593-1479615 GTGCGGCTGCACTCCGGCCTGGG + Intergenic
1133298403 16:4766927-4766949 CCGGGTCTGTGCCGCGGCCTCGG - Intronic
1133308451 16:4826816-4826838 CTGGGGCAGCACAGCTGTCTTGG + Intronic
1134279274 16:12803583-12803605 CCGGGGCTGCACCGGGGCCTGGG - Intronic
1136186786 16:28593094-28593116 ATGGGGCTGCAGTGGGGCCTGGG + Intronic
1138351515 16:56348514-56348536 CTGGGCCTCCACTGCAGCCTGGG + Intronic
1138376854 16:56570121-56570143 CTGGGGCTGCTCTGTGACCTTGG - Intergenic
1140628446 16:76822774-76822796 CTGAGGCTGCACCTAGACCTAGG + Intergenic
1141639570 16:85333456-85333478 GTGCGGCTGCAGCCCGGCCTCGG + Intergenic
1141831282 16:86511125-86511147 CTGGCGCTGGAGGGCGGCCTGGG + Exonic
1142274635 16:89111354-89111376 CTGGGGCTGGACTGTGGCATCGG + Intronic
1142393258 16:89816370-89816392 CTGGGGCGGCGCGGCTGCCTCGG - Intronic
1142402417 16:89867185-89867207 ATGGCACTGCACCGCAGCCTGGG - Intronic
1142753652 17:2002920-2002942 CTGGGGCAACACGCCGGCCTCGG - Intronic
1142835081 17:2579565-2579587 CTGCCGCTGCACCCCAGCCTGGG - Intergenic
1143068132 17:4265814-4265836 CTGCCGCTGCACTGCAGCCTGGG + Intergenic
1144876105 17:18398248-18398270 CTGGGGCTGCCCCAAAGCCTGGG + Intergenic
1145029763 17:19495573-19495595 CTGGGGCTGCACCCCTGCCTAGG + Intronic
1145156123 17:20546172-20546194 CTGGGGCTGCCCCAAAGCCTGGG - Intergenic
1147671778 17:42180717-42180739 CTGTTCCTGCACCGCGGCTTTGG + Intronic
1148023346 17:44568236-44568258 CTGGGGCTGCACGGGGCGCTTGG + Intergenic
1150679899 17:67276331-67276353 CTGGCGCTGCCCCTCTGCCTGGG + Intergenic
1151537630 17:74747953-74747975 CTGGAGCTGCACCCAGGCTTTGG + Intergenic
1151712111 17:75812910-75812932 CTGGGGCTGTCCCATGGCCTGGG + Intronic
1151834919 17:76576198-76576220 CTGAGACTGCACTGCAGCCTGGG + Intronic
1151887480 17:76931783-76931805 CCGTGACTGCACCCCGGCCTAGG - Intronic
1152084620 17:78210402-78210424 CAGGGGCTGCGCAGCGGGCTCGG + Intergenic
1152405389 17:80095348-80095370 CTTGCGCTGCCCCTCGGCCTGGG - Exonic
1152963655 18:96461-96483 CGAGGTCTACACCGCGGCCTTGG - Intergenic
1154167938 18:12029888-12029910 CTGGGGGTGCACCGCTGCTGCGG - Intronic
1156347650 18:36272433-36272455 CTGCCACTGCACAGCGGCCTGGG + Intergenic
1158490554 18:57906178-57906200 CTGAGGGTGCACAGCAGCCTGGG - Intergenic
1160292482 18:77607262-77607284 CTTGGGCTGCTCCGCCGCCTGGG - Intergenic
1160497770 18:79385247-79385269 GTGGGGCTGGACCACAGCCTGGG - Intergenic
1160530116 18:79557604-79557626 CTGGGGCTGCTCCCAGGCCGAGG + Intergenic
1160674260 19:380718-380740 CTGCCACTGCACTGCGGCCTGGG + Intergenic
1160703647 19:519310-519332 CTGGCGCTGGACCGCGCCGTCGG + Exonic
1160711262 19:552189-552211 CTGAGGCTGCACTCCAGCCTGGG - Intergenic
1160773407 19:843804-843826 CTGGGGCTGCACCGCGGCCTCGG + Intronic
1160859961 19:1233577-1233599 CCGGGGCTGCAGCAGGGCCTGGG - Exonic
1161000024 19:1905879-1905901 CTGGGGATGTACCAAGGCCTAGG - Intronic
1161053712 19:2179345-2179367 CTGAGGCTGCACGGCTGCCTGGG + Intronic
1161053718 19:2179377-2179399 CTGAGGCTGCACGGCTGCCTGGG + Intronic
1161348497 19:3779482-3779504 TTGGGGCTGCTCCGCTGCGTGGG + Intronic
1161434348 19:4253536-4253558 CTGCCGCTGCACTCCGGCCTGGG + Intronic
1163148702 19:15398928-15398950 CTGGGGCGGCACAGGCGCCTTGG + Intronic
1163560104 19:18014000-18014022 CTGGGGCAGGGCCCCGGCCTGGG + Exonic
1163649402 19:18508552-18508574 CTGGCACTGCACAGGGGCCTGGG + Intronic
1165255975 19:34577501-34577523 CCGGGGCTGCAGCGCGGCCCGGG + Intergenic
1165506244 19:36232150-36232172 CTGAGACTGCACTCCGGCCTGGG + Intronic
1166149809 19:40864367-40864389 ATGTGGCTGCACCTCAGCCTGGG + Intronic
1166726664 19:45032588-45032610 CTGGCGGTGCACGTCGGCCTGGG - Exonic
1166894427 19:46015185-46015207 CTGCGGCAGGAGCGCGGCCTCGG + Exonic
1167259612 19:48450976-48450998 CTTGGGCTTCACTGCGGGCTGGG + Intronic
1167483118 19:49745313-49745335 CTGCGGCTGCTCGGGGGCCTGGG - Exonic
1167688198 19:50969357-50969379 CTGGGGGTGCAGGGAGGCCTGGG - Intronic
1168416427 19:56172037-56172059 CTGGGGCTCAGCTGCGGCCTGGG + Intergenic
927197846 2:20560301-20560323 CTGGGGCAGCACCCAGGCCTGGG + Intergenic
928180432 2:29064887-29064909 CTGGGGCTGCGCCTCTGGCTGGG + Exonic
930177412 2:48314861-48314883 CGGGAGCTGCGCCGCGGGCTGGG - Intronic
931040353 2:58290903-58290925 CAGGGGCTGAGCAGCGGCCTGGG + Intergenic
931499913 2:62854917-62854939 CTGGGTCTGCAGCACGGCTTGGG - Intronic
933078638 2:77960415-77960437 CTGCCGCTGCACTGCAGCCTGGG + Intergenic
936058711 2:109280502-109280524 CTGGGGCTCCACTGGGGCCATGG + Intronic
938172101 2:129088416-129088438 CTGAGGCTGCACAGAGGCCAAGG - Intergenic
939153928 2:138502141-138502163 CTGGGGCTGCCGCGGGGACTGGG - Intronic
941404372 2:165070377-165070399 GTGGAGCTGCACAGTGGCCTGGG - Intergenic
944606691 2:201358267-201358289 CTGCCACTGCACCGCAGCCTGGG - Intergenic
946003686 2:216504972-216504994 CTGAGACTGCACTGCAGCCTGGG + Intronic
947595586 2:231409690-231409712 CTGGGCCTCCACCTGGGCCTGGG - Intergenic
947723562 2:232383044-232383066 CTGGCGCTGCCCCAGGGCCTTGG - Intergenic
947840482 2:233204485-233204507 CTTGGCCGGCACCGGGGCCTGGG - Exonic
948206997 2:236167753-236167775 CGCTGGCTGCAGCGCGGCCTGGG + Exonic
948831049 2:240598433-240598455 CTGGGGCTGCCTGGTGGCCTAGG + Intronic
949023371 2:241753633-241753655 CTGAGGCTACAGCGGGGCCTGGG - Intronic
1169149053 20:3275057-3275079 CTGTGGCTGCACCAGGGCATGGG - Intronic
1171013850 20:21522766-21522788 CTGGGGCTGCGCGGTGGCCGCGG - Intergenic
1171452684 20:25247478-25247500 CTGTGGCTGCCTCGCGCCCTCGG + Intergenic
1172006449 20:31821760-31821782 CTGGGGCTGCCCTGGGGCCAGGG + Intronic
1172640226 20:36436275-36436297 CTGGCGCCGCGCCGCGGTCTTGG - Exonic
1175198768 20:57264532-57264554 CTGGGGCTGCAGCGAGGGCCGGG - Intronic
1175215285 20:57389295-57389317 CCGGGGCTGCCCTGCCGCCTGGG + Intergenic
1175410145 20:58762397-58762419 CTGGGGCTGCTCTGCTGGCTCGG - Intergenic
1175972465 20:62693603-62693625 CTGGGACTTCATCTCGGCCTTGG - Intergenic
1175999660 20:62826153-62826175 CTGGGGCTGCACCTCCACCCCGG - Intronic
1176033255 20:63024015-63024037 CTGGGGCTACACAGCCCCCTAGG - Intergenic
1176060656 20:63171327-63171349 CTGGGGCTGGCCCTCTGCCTGGG - Intergenic
1176146876 20:63569415-63569437 CTGGGGCTGCAGCTGGGCCAGGG - Exonic
1176296232 21:5074984-5075006 CAGGGGCTGCACGAAGGCCTGGG + Intergenic
1176386537 21:6140933-6140955 CTGGGGGTTCCCCGCAGCCTTGG + Intergenic
1178869895 21:36364601-36364623 CTGAGGCTGCACCCCAGCCTGGG + Intronic
1179617894 21:42593593-42593615 CTGGGGCTGCACTCAGTCCTGGG + Intergenic
1179714270 21:43279796-43279818 CTGCTGCTGCCCCGGGGCCTTGG - Intergenic
1179736936 21:43397319-43397341 CTGGGGGTTCCCCGCAGCCTTGG - Intergenic
1179860817 21:44187137-44187159 CAGGGGCTGCACGAAGGCCTGGG - Intergenic
1180169611 21:46050997-46051019 CAGCGGCTGCACGGTGGCCTGGG + Intergenic
1180190081 21:46158776-46158798 CTGGGGCAGCACCCGGGCCCTGG - Intergenic
1182630562 22:31682117-31682139 CATTGGCTGCACCGCGGCCTTGG + Exonic
1183174187 22:36210687-36210709 CTGCTGCTGCACCCCAGCCTGGG - Intergenic
1183255447 22:36758842-36758864 CTGGTGCTGGACCCAGGCCTGGG + Intronic
1183513665 22:38250759-38250781 CTGGGGTTGCCCCTCTGCCTGGG - Intronic
1183739460 22:39661994-39662016 ATGGGGCCGCAGCGCGGCCTGGG + Exonic
1184067446 22:42128710-42128732 CCGGGGCTGGACTGGGGCCTCGG - Intronic
1184163977 22:42716640-42716662 CTGGGGCTGCACCAGGGCTAGGG + Intronic
1184683959 22:46087687-46087709 CTGGTGGAGCACCGGGGCCTTGG + Intronic
1185055020 22:48575107-48575129 CTGGGGCGGTACCTGGGCCTGGG + Intronic
1185268578 22:49918088-49918110 CTGGGGCTGCACCCCTCACTTGG - Intronic
1185383129 22:50519277-50519299 CTTGGGCTCCAGAGCGGCCTTGG - Exonic
952965802 3:38620596-38620618 CTGGGGCTCCACGGCAGCCCTGG - Intronic
954370093 3:50165787-50165809 CTGGGGCTGCCCAGCAGGCTGGG - Intronic
954385087 3:50239878-50239900 CAGGGGCTGCTCCGCAGCCCTGG + Intronic
961360528 3:126364551-126364573 CTGGGGCTGGAGAGTGGCCTTGG - Intergenic
967141683 3:186567053-186567075 CTGGGGCTTCGCCGCCACCTTGG + Intronic
967883682 3:194318804-194318826 CTGGAGCTGTACCTGGGCCTGGG + Intergenic
968094531 3:195918995-195919017 CTGCCACTGCACCCCGGCCTGGG + Intergenic
968426375 4:526275-526297 CTGGGGCCACACGGGGGCCTGGG - Intronic
968530809 4:1090494-1090516 CTGGGGCAACACTGGGGCCTTGG - Intronic
968603248 4:1520298-1520320 GTGGGGCTGCGCCACGGCCCCGG + Intergenic
968656323 4:1779876-1779898 CTGGGGCTGCTCCCAGCCCTGGG - Intergenic
970939442 4:21614100-21614122 GTGGGGCTGCACTCCAGCCTGGG + Intronic
973608519 4:52611218-52611240 CTGGGGCTGGCCTGCAGCCTGGG + Intronic
973718724 4:53702554-53702576 CTGAGGCTGCAGGGCGGCCGGGG + Intronic
976199088 4:82561785-82561807 CGGGGGCTGCAGCGCGGCTGGGG - Intronic
978221215 4:106276817-106276839 CTGGAACTGCACCGCCTCCTGGG - Intronic
978839236 4:113190201-113190223 CTGAGGCTGCACTCCAGCCTGGG - Intronic
979382398 4:120022607-120022629 CAGGGGCTGCCCCTCAGCCTCGG + Intergenic
982004248 4:151049297-151049319 GTGGGGCTGCTCAGCGGCCTGGG + Intergenic
982959439 4:161818238-161818260 GTCGGGCTGCTCAGCGGCCTGGG - Intronic
983939298 4:173524078-173524100 CTGGGCCTGCACAGCGGTCTGGG + Intergenic
985129274 4:186724600-186724622 CTGGGGCTTCCCCTCTGCCTAGG - Intronic
985610385 5:884707-884729 CTGGGCCTGCACCTGGCCCTAGG - Intronic
985791602 5:1931164-1931186 CAGGGGCTGCGCCGCGTCCCCGG + Intergenic
985965640 5:3337208-3337230 TTTGGGCTACACAGCGGCCTTGG + Intergenic
986732964 5:10648977-10648999 CTGGGGCTACACCACCGCCCAGG - Intronic
989012279 5:36886259-36886281 CTGGTGCTGCCCCTCTGCCTGGG - Intronic
999728285 5:154455263-154455285 CTGTGACTGCACCCCAGCCTAGG - Intronic
1000897926 5:166878747-166878769 GTGCGGCTGCACTCCGGCCTGGG + Intergenic
1001031927 5:168269421-168269443 CTGTGGCTGCACGCCGCCCTCGG + Intergenic
1001677071 5:173527922-173527944 CTGGGGCTGTTCCAGGGCCTTGG + Intergenic
1002923371 6:1589720-1589742 CTGGGGCAGCACCTCAGCCTCGG + Intergenic
1004043953 6:12009173-12009195 CTGGCGCGGCCCCGCGGCCCCGG - Intronic
1005687313 6:28267243-28267265 CTGGGGCGGAACTGCGGCCTAGG + Intronic
1006697565 6:35944104-35944126 CTGGGGCTCCATCTCGGTCTGGG + Exonic
1007081198 6:39105759-39105781 CTGGGGCTGAGCCGCTTCCTAGG + Exonic
1007174098 6:39884621-39884643 CTGGGGCTGGGCCTGGGCCTGGG + Intronic
1007432727 6:41786139-41786161 CTGGCGCTGCACCGAGGCGGAGG + Exonic
1008002632 6:46376644-46376666 CTGTGGCTGCACACCAGCCTGGG + Intronic
1011753034 6:90472473-90472495 CTGGGGCTGCACTTCAGCCTGGG + Intergenic
1012937887 6:105387172-105387194 CTGCCACTGCACTGCGGCCTGGG + Intronic
1015773592 6:136792483-136792505 CTTGAGCTGCACCGCGGCGCAGG - Exonic
1016760002 6:147726527-147726549 CTGGGCCTGGACCTGGGCCTGGG - Intronic
1017967756 6:159281208-159281230 CTAGGGCTGCAAGGTGGCCTTGG - Intergenic
1018430333 6:163716820-163716842 CTTTGGCTGCACCTGGGCCTTGG + Intergenic
1019290410 7:247416-247438 CTGGGGCCGCACCCCAGGCTGGG - Intronic
1019333825 7:473335-473357 ATGGGGCTGCACAGGGGCCCAGG + Intergenic
1019337462 7:492115-492137 CTTGGGCTGCACCACTGCCCTGG - Intergenic
1019498623 7:1353050-1353072 CTCCGTCTGCACCTCGGCCTGGG + Intergenic
1019586141 7:1804902-1804924 CTGGGGCTGCACCGTGGATTTGG - Intergenic
1020221636 7:6242899-6242921 GTGAGGCTGCACAGAGGCCTGGG + Intronic
1021640659 7:22733299-22733321 CTGGGGCTGCACTCCATCCTGGG + Intergenic
1022956647 7:35386939-35386961 CTGGGGCTGGAGAGAGGCCTAGG - Intergenic
1023870754 7:44261960-44261982 CTGGGGCTGCAGCCTGGCCCCGG + Intronic
1025200061 7:56956588-56956610 CTGGGGAGGGACCGGGGCCTGGG - Intergenic
1025638978 7:63349820-63349842 CCGGGCCGGCACCGCGGCCTCGG - Intergenic
1025643721 7:63398272-63398294 CCGGGCCGGCACCGCGGCCTCGG + Intergenic
1025671883 7:63620344-63620366 CTGGGGAGGGACCGGGGCCTGGG + Intergenic
1025713309 7:63931301-63931323 CCGGGCCAGCACCGCGGCCTCGG + Intergenic
1029701515 7:102249231-102249253 GTGGGTCTGGGCCGCGGCCTTGG - Exonic
1034539320 7:151746110-151746132 CTGGGAATGCACCGAAGCCTTGG + Intronic
1034876599 7:154730008-154730030 GAGGGGCTGCACCTCTGCCTGGG + Intronic
1035433431 7:158839854-158839876 CTGGGGCTGCACTCCAGCCTGGG - Intergenic
1035523158 8:291287-291309 CTGGTGCTGCAGCACGGCCTTGG - Intergenic
1035630600 8:1104195-1104217 CTGAGGCTCCACCGTGGCCGGGG - Intergenic
1035983325 8:4397575-4397597 CAGGTGCTGCACTGTGGCCTGGG - Intronic
1036195125 8:6707889-6707911 CTCGAGCTGCCCCGCGACCTGGG + Intergenic
1036453592 8:8890732-8890754 CTGGGGGTGGACCGCGCCATGGG + Exonic
1036453810 8:8891832-8891854 CCGGGGCTGCACCGCCGGCTGGG + Exonic
1039399116 8:37253631-37253653 CTGAGGCTGCACACCAGCCTGGG - Intergenic
1040039039 8:42897449-42897471 CTGGGGCTGCGCTGCGCTCTGGG + Intronic
1040305266 8:46208720-46208742 ATGGGGCTGCACGGTGGCGTGGG + Intergenic
1040836328 8:51735440-51735462 CTGCCGCTGCACCCCAGCCTGGG + Intronic
1043758240 8:84031430-84031452 CTGGGCCTGCAGCACGGCTTGGG - Intergenic
1046772170 8:118127010-118127032 CTGGAGCTGAACAGCTGCCTGGG + Intergenic
1048546478 8:135392168-135392190 GTGGCACTGCACCGCAGCCTGGG - Intergenic
1048833351 8:138496956-138496978 CTGGGGCTGCCCGGAGGCCGCGG - Intergenic
1049565455 8:143335648-143335670 CTCTGGCAGCACCGCAGCCTTGG + Intronic
1049596487 8:143486342-143486364 CTGGGGCCGCACCGAGGCTCTGG + Intronic
1049603549 8:143518963-143518985 CTGGGGCTGCACCCCGTGCTTGG - Intronic
1049762115 8:144336470-144336492 CAGGGGCGGCACTGCGGGCTGGG - Intergenic
1051513749 9:17907034-17907056 CTGGGGCTGCGCTGCCGCCCAGG + Intergenic
1052824988 9:33167687-33167709 CTGGGCCTGCAGCGCGGCGGCGG + Intergenic
1054798647 9:69325446-69325468 CGGGGGCTGCAGCGCGCCCCGGG - Intronic
1056329711 9:85511315-85511337 CTGGGGCTGGGCCAGGGCCTGGG - Intergenic
1056875738 9:90328652-90328674 CTGGGGCTGCCCAGGGGCCTTGG + Intergenic
1060408265 9:123383346-123383368 CAGGGGCTGCAGCCCTGCCTGGG + Intronic
1060741059 9:126097866-126097888 CTGGGGCAGGACAGCTGCCTTGG - Intergenic
1061170027 9:128947314-128947336 CTGGGGCTTCACGGAGGCCGGGG + Exonic
1061302430 9:129713165-129713187 ATGGGGCTGCACCCCTGCCGTGG - Intronic
1061320231 9:129823755-129823777 CTAGGGCTGGAGCGGGGCCTGGG - Intronic
1061482635 9:130904551-130904573 CTGGGGCTGCCCCTGGGTCTAGG + Intronic
1061623655 9:131827755-131827777 GTGGGGCAGCACGGCAGCCTGGG + Intergenic
1061925731 9:133805242-133805264 CTGGGTCTGCTCTGGGGCCTGGG - Intronic
1061970108 9:134040318-134040340 CTGGGGCTGCGTGGCGCCCTGGG + Intronic
1062031892 9:134365541-134365563 CTGGGGCTGCACTGGGGCCTGGG + Intronic
1062047612 9:134431713-134431735 CAGGGGCGGCACCTGGGCCTGGG + Intronic
1062137477 9:134937344-134937366 CTGAGCCTGCACTGGGGCCTTGG + Intergenic
1062180292 9:135187764-135187786 CGGGGGCTGCAGAGGGGCCTTGG - Intergenic
1062404925 9:136391695-136391717 CTGGGCATGCACCGCTGCATGGG + Intronic
1062574497 9:137200062-137200084 CGGGGTCTGCACCGCGGCGCGGG - Exonic
1062592125 9:137278861-137278883 CGGGGGCTGCAGCCCGGCCTGGG - Exonic
1062734445 9:138127265-138127287 CGAGGTCTACACCGCGGCCTTGG + Intergenic
1185457735 X:319189-319211 CGGCGGCTGCACCGCGGGATGGG - Intergenic
1186618650 X:11215066-11215088 CTGGGGCTGCTCCTGGGCCCTGG - Intronic
1189327726 X:40123025-40123047 CTGGGGCAGCTCGGAGGCCTGGG + Intronic
1190108408 X:47574403-47574425 CTGGGTCGGCGGCGCGGCCTGGG + Exonic
1190325948 X:49206891-49206913 CTGGGCCTGGACCTGGGCCTGGG + Intronic
1190533972 X:51407886-51407908 CTGGCGCAGAATCGCGGCCTCGG - Exonic
1190533980 X:51407919-51407941 CTGGCGCAGAATCGCGGCCTCGG - Exonic
1190533987 X:51407952-51407974 CTGGCGCAGAATCGCGGCCTCGG - Exonic
1194971639 X:100350822-100350844 CTGCTGCTGCACTGTGGCCTTGG - Intronic
1195751548 X:108165012-108165034 CTGGGGGTCCAGCGGGGCCTGGG + Exonic
1196108102 X:111917748-111917770 CTGGGGCTGGACAGAGTCCTTGG - Intronic
1198515857 X:137405970-137405992 CTGGGGCGCCACCGCGGCTCTGG + Intergenic
1199591393 X:149471151-149471173 CTGTGGCTGCCCAGGGGCCTGGG + Intergenic
1199649931 X:149940302-149940324 CTGTGGCTGCAGCGGGGACTGGG + Intergenic
1202197123 Y:22307579-22307601 CCGGGGATGTCCCGCGGCCTGGG + Intergenic