ID: 1160774029

View in Genome Browser
Species Human (GRCh38)
Location 19:846597-846619
Sequence CTGTGGTCCTAGAGGGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 277}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160774029_1160774047 30 Left 1160774029 19:846597-846619 CCCACTCCCCTCTAGGACCACAG 0: 1
1: 0
2: 1
3: 23
4: 277
Right 1160774047 19:846650-846672 GGCGGCCCCTTCCAGAATCCAGG 0: 1
1: 0
2: 2
3: 13
4: 141
1160774029_1160774039 9 Left 1160774029 19:846597-846619 CCCACTCCCCTCTAGGACCACAG 0: 1
1: 0
2: 1
3: 23
4: 277
Right 1160774039 19:846629-846651 GGAGACCCATCCGCCCTCACCGG 0: 1
1: 0
2: 0
3: 11
4: 97
1160774029_1160774040 12 Left 1160774029 19:846597-846619 CCCACTCCCCTCTAGGACCACAG 0: 1
1: 0
2: 1
3: 23
4: 277
Right 1160774040 19:846632-846654 GACCCATCCGCCCTCACCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160774029 Original CRISPR CTGTGGTCCTAGAGGGGAGT GGG (reversed) Intronic
900351897 1:2238946-2238968 GTGTGGACCTGGAGGGGGGTGGG + Intronic
900739208 1:4320437-4320459 CTGTGCTCCTAGAGAAAAGTTGG + Intergenic
901055163 1:6445844-6445866 CTGTGGTCCTACAGGAGGCTTGG - Exonic
901879050 1:12183197-12183219 CTGTGGACCCAGATGGGAGGCGG + Intronic
901916702 1:12505764-12505786 CTGTGATCCTTGCGGGGAGGGGG + Intronic
904316721 1:29670656-29670678 CTGTGGTCCCAGAGAGGTGAAGG + Intergenic
904607426 1:31705372-31705394 CTGTGGTCCCAGTGAGGAGCTGG + Intergenic
905120587 1:35678830-35678852 GTGTGGGCCTGTAGGGGAGTGGG - Intergenic
905409169 1:37756394-37756416 CTGCTGTCCTAGAGGTGGGTGGG + Intronic
907097359 1:51793825-51793847 CCGTGGTTCTAGAAGCGAGTGGG + Intronic
909898775 1:81108015-81108037 CTGTGGTCCAAGAGTGTACTTGG + Intergenic
911514511 1:98850412-98850434 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
913330952 1:117667014-117667036 CTTTGGCCCTTGAGGGCAGTGGG + Intergenic
914420764 1:147526685-147526707 CAGAGATCCTAGTGGGGAGTGGG + Intergenic
916945999 1:169728082-169728104 ATGTGGCCCCACAGGGGAGTGGG - Exonic
917240699 1:172945396-172945418 CTGTGGTCCAAGACAGGAGAAGG - Intergenic
918081805 1:181213614-181213636 CTGTGGTCTGAGAGGGAAGAAGG + Intergenic
919243720 1:194949753-194949775 CTGTGGTTCAAGAGGATAGTTGG - Intergenic
919425623 1:197426710-197426732 CTGTGGTCCTGGTTGGGAGTAGG - Intronic
919729079 1:200901494-200901516 CTGTGGGCCTGGAGGGCAGCGGG - Intronic
921162046 1:212479828-212479850 CTGGGGTCCCAGAGGTGACTGGG - Intergenic
921675545 1:217971915-217971937 CTGTGGTCCAAGAATGGGGTTGG + Intergenic
922603629 1:226875121-226875143 CTGTGGTCCGGGAGGGTGGTAGG + Intronic
922971520 1:229745277-229745299 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
923929797 1:238682428-238682450 CTGTGGTCCAAGAGGGTGGCTGG - Intergenic
924238883 1:242022443-242022465 CTGGGGTCCTAGATGGAATTAGG - Intergenic
1066539802 10:36433730-36433752 CTCTAGTGCTAGAGTGGAGTAGG + Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067540712 10:47150338-47150360 CTGTGGTCCTATAGAGGAAAAGG - Intergenic
1068420935 10:56792175-56792197 CTGTTGTTTTAGAGGGGAGATGG - Intergenic
1069052095 10:63805962-63805984 CTGTGGTGATAGAGGGGAGAAGG - Intergenic
1070643789 10:78187395-78187417 CTGAGGTCCAAGAGGGATGTTGG + Intergenic
1072249245 10:93568516-93568538 AAGTGGTCAGAGAGGGGAGTAGG + Intronic
1072509814 10:96109278-96109300 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
1073022821 10:100460727-100460749 CTGTTATCCTAGAGGGGAGAAGG + Intergenic
1073804608 10:107083784-107083806 AGGAGGCCCTAGAGGGGAGTGGG + Intronic
1073863476 10:107773377-107773399 CTGTGGTTTTAGAGAGCAGTTGG - Intergenic
1076495933 10:130897963-130897985 CTGGGGTCCTAGTGGGCAGGGGG + Intergenic
1079485135 11:20928234-20928256 CTGTGGTCCTGGAGTGGACTGGG + Intronic
1080256768 11:30298685-30298707 CTGTGGTCCCAGAGTGTGGTTGG - Intergenic
1081619414 11:44610265-44610287 CTGTGGTCCTAGCTGGGACTTGG + Intronic
1083894083 11:65611533-65611555 CAGGGGAACTAGAGGGGAGTAGG + Intronic
1084067885 11:66715802-66715824 CTGTGGTCATGAAGGGAAGTGGG - Intronic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1085731640 11:79004406-79004428 CTGTGGTCCAAGAGCGTGGTTGG - Intronic
1086063474 11:82723516-82723538 ATGAGGTCCTAGAGGCAAGTGGG + Intergenic
1087040602 11:93795705-93795727 CTGTCGTCTTAGAAGGAAGTAGG + Intronic
1087918183 11:103834209-103834231 CTGTGGTCCAGGAGTGTAGTTGG - Intergenic
1087978141 11:104575909-104575931 CTGTGTTCTCAGAGGGGAGAAGG - Intergenic
1089131375 11:116214955-116214977 CTGAGGTCCCAGAGAGGAGAGGG - Intergenic
1089203372 11:116739110-116739132 CTGTGGTCATAATGGGGAGCAGG - Intergenic
1089869279 11:121657655-121657677 CCCTGATCCTAGAGGGGACTTGG + Intergenic
1090593245 11:128294062-128294084 CTGTGGTCCTTGCGGTGAGAGGG - Intergenic
1090704742 11:129326103-129326125 CTGTGGTCAAACAGGGGACTAGG - Intergenic
1091770135 12:3146083-3146105 CTGAGGTCCAGGAGGGGAGTGGG - Intronic
1092264382 12:6969970-6969992 CTGTGGTCGTGGAGAGGAGCAGG - Intronic
1092720373 12:11435072-11435094 CTGAGGTCCTAGAGGAGAGCTGG + Intronic
1093344093 12:18018858-18018880 CTGTGGTCCTAGAGAATGGTTGG - Intergenic
1093541813 12:20296587-20296609 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
1094764490 12:33576581-33576603 CTGTGGTCCTAGAAAGTGGTTGG - Intergenic
1096056242 12:48654844-48654866 ATGTGCTCCTGGAGGGGAGTGGG - Intronic
1099394781 12:82123889-82123911 CTGTGGTCCAAGAGAGTGGTTGG - Intergenic
1099866274 12:88286046-88286068 TTGTGGTACTAGAGTAGAGTTGG + Intergenic
1100266523 12:92981673-92981695 CTGTGGTCCAAGAGTGTAGTTGG - Intergenic
1101376001 12:104172209-104172231 CAGTGCTCCTGGAGGGGAGCAGG + Intergenic
1103328490 12:120137569-120137591 CTGTGGTTCTGGAGGAGAGCTGG - Exonic
1103560863 12:121792865-121792887 CTGTGGTTCTAGAAAGCAGTGGG - Intronic
1107361426 13:39621758-39621780 CTGTGGTCTGAGAGGGTAGTTGG - Intergenic
1108283218 13:48879982-48880004 CTGTGTTCCTTCAGGGGAGTAGG - Intergenic
1109317980 13:60774394-60774416 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
1111170707 13:84522838-84522860 CTATTGTGCTAGAGTGGAGTAGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1114589580 14:23848539-23848561 CTGTGGTCCAAGAGTGTATTTGG + Intergenic
1114686703 14:24539044-24539066 CTGTGGTCCAAGAAGGTTGTTGG - Intergenic
1115868557 14:37775578-37775600 CTGTGGTCCAAGAGTGTGGTTGG + Intronic
1115890778 14:38025960-38025982 CTGTGGTCCGAGAGTGTGGTTGG - Intronic
1116872730 14:50083705-50083727 CTGCGTTCCTGGAGGGGTGTGGG + Exonic
1117389325 14:55247999-55248021 CTGTGGCCATAGAGGGTGGTAGG + Intergenic
1118068708 14:62221602-62221624 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
1118415826 14:65535630-65535652 CTGTGTTCCGAGAGAGTAGTTGG + Intronic
1118615217 14:67570295-67570317 CTCAGGTCCCAGAGGGCAGTGGG + Intronic
1118982417 14:70727536-70727558 CTGTGGTCCTGGTCGGGAGCAGG - Intronic
1119269421 14:73288925-73288947 CTGTGGTCCTACTTGGGAGGTGG + Intronic
1119857199 14:77909498-77909520 ATGTGGTCCCAATGGGGAGTTGG + Intronic
1121089339 14:91170385-91170407 CAGTGGTCCCAGAGGTGAGTGGG - Intronic
1121652425 14:95568940-95568962 GTGTGGTCACAGTGGGGAGTGGG + Intergenic
1122297114 14:100711925-100711947 CTCGAGGCCTAGAGGGGAGTGGG + Intergenic
1122824299 14:104362207-104362229 CTGTGTCCCTACTGGGGAGTGGG + Intergenic
1124161860 15:27277906-27277928 ATGTGGTCCCTGAGGGAAGTGGG - Intronic
1125534480 15:40435556-40435578 CTGAGATCCAAGAGGCGAGTTGG - Intronic
1125691630 15:41600662-41600684 GTGTTGTCCTTGAGGGCAGTGGG + Intergenic
1126745892 15:51826256-51826278 CTGTGTCCCAAGAGGAGAGTAGG + Intergenic
1127351102 15:58153333-58153355 CTATAGTGCTAGAGTGGAGTAGG - Intronic
1128739078 15:70071348-70071370 CTGTGGTCCAGCAGGGGAGTGGG + Intronic
1128874881 15:71193831-71193853 CTGTAGTCCCAGGGGGGACTAGG - Intronic
1130891940 15:88140842-88140864 ATATGGGCCTAGAGTGGAGTGGG + Intronic
1130985812 15:88843692-88843714 ATGGGGTCCTAGAGGGAAGAGGG + Intronic
1134289175 16:12889853-12889875 CCGGGGTCCTGTAGGGGAGTGGG + Intergenic
1136650906 16:31669540-31669562 CTCTGGTTCTCAAGGGGAGTTGG + Intergenic
1136687571 16:32004123-32004145 CTGGGGTCCCACAGGGTAGTGGG - Intergenic
1136788181 16:32947674-32947696 CTGGGGTCCCACAGGGTAGTGGG - Intergenic
1136881603 16:33906115-33906137 CTGGGGTCCCACAGGGTAGTGGG + Intergenic
1137674920 16:50299464-50299486 CAGGGGACCTAGAGGGGAGCGGG - Intronic
1137875341 16:51991501-51991523 CTTTGGCCCGAGTGGGGAGTTGG + Intergenic
1138776748 16:59732216-59732238 CTGTGGTCCAAGAGTGTGGTTGG - Intronic
1141435844 16:83999281-83999303 CTGTCCTCCTGGAGTGGAGTGGG - Intronic
1141749217 16:85946995-85947017 CTGGGGTCTTGGAGGGGAGCAGG - Intergenic
1203090410 16_KI270728v1_random:1209331-1209353 CTGGGGTCCCACAGGGTAGTGGG - Intergenic
1142479334 17:208536-208558 CTTTGGTCCTACAGAGGCGTGGG + Intergenic
1142523033 17:518452-518474 CTGTGGACCTGAAGGTGAGTGGG + Exonic
1144341676 17:14315235-14315257 ACGTGGTCCTACAGGAGAGTTGG - Intronic
1144412764 17:15017560-15017582 CTCTGGTCCTAGAGCAGAGAAGG + Intergenic
1144466702 17:15502934-15502956 CTTTGGGCCTGGAGGGGAGGTGG - Exonic
1144511810 17:15883480-15883502 CTGTGGTTCTGGAGGAGAGGAGG + Intergenic
1147148552 17:38499792-38499814 CTGGGGTCCCACAGGGTAGTGGG - Intronic
1147758056 17:42781132-42781154 CTGTGGCCCTAGAGCGGCGGCGG + Exonic
1148754729 17:49967093-49967115 CTGTTGGACGAGAGGGGAGTGGG + Intergenic
1148876347 17:50689724-50689746 GTGGGGTCCTAAATGGGAGTGGG - Intronic
1150533513 17:66011567-66011589 CTGTGGTCCAAGAGTGTAGCTGG + Intronic
1151195809 17:72430545-72430567 CTCTGGTCCTTAAAGGGAGTAGG + Intergenic
1151508751 17:74545624-74545646 TAGCGGTCATAGAGGGGAGTGGG - Intronic
1151516834 17:74601850-74601872 CTATGGTCCTAGAGCTGTGTGGG + Intergenic
1153340345 18:3966950-3966972 CTGAGGTCCAAGAGAGGAGGAGG + Intronic
1155602811 18:27568971-27568993 CTGTGGTCCTAGGTGGGAACAGG - Intergenic
1155779605 18:29814222-29814244 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
1157161665 18:45319143-45319165 CAGTGGTCCTAAAGAGGAGCTGG - Intronic
1157977040 18:52339723-52339745 CTCCCGTCCTAGAAGGGAGTTGG + Intergenic
1158703492 18:59770467-59770489 CTGTAGTCCTTGAAGGGAGAAGG + Intergenic
1158711363 18:59840976-59840998 GTGTGGTCCTGGATTGGAGTTGG + Intergenic
1159359134 18:67378859-67378881 CTGTGGTCCAAGAGTTGGGTTGG + Intergenic
1160724745 19:613154-613176 CTGGGGTCCGAGAGGTGAGCCGG + Intronic
1160774029 19:846597-846619 CTGTGGTCCTAGAGGGGAGTGGG - Intronic
1161010907 19:1958907-1958929 CTGTGGCCCTGGACGGGGGTGGG - Intronic
1162612145 19:11765075-11765097 CTGTGGTCTGAGAGTGCAGTTGG + Intergenic
1163312311 19:16521806-16521828 CTGAGGTCCTACAAGAGAGTGGG - Intronic
1163817567 19:19476062-19476084 CTCTGGTCATGGAGGGGACTCGG + Intronic
1165026995 19:32969498-32969520 CTCTGATCTTGGAGGGGAGTCGG - Intronic
1165141747 19:33704000-33704022 CTGGGGTCCCAGAGGGAAGTCGG + Intronic
1165152198 19:33767327-33767349 CTGTGAGCCTAGAGAGGAGCGGG + Intronic
1166699537 19:44874315-44874337 CTGAGGTCCTGGAGGGGTGTGGG - Exonic
1167642119 19:50687709-50687731 CTGTGGTGGTAGAGGGTGGTGGG - Intronic
1168544733 19:57240860-57240882 CTGTGGCCCTAGCGGGGCGGGGG - Intronic
925859110 2:8157825-8157847 CTGGGGTCCTGGAAGGGAGAGGG - Intergenic
927872735 2:26633877-26633899 CTGAGGCCCGAGAGGGGACTTGG - Intronic
931580664 2:63768923-63768945 CTTTGGTCCTAGAGATTAGTGGG + Intronic
932005450 2:67922604-67922626 CTGTTGGCCTTGAGGGGAGAAGG + Intergenic
932201904 2:69836052-69836074 CTGTGTTCATAGAGTGGAGAAGG + Intronic
934218854 2:90062593-90062615 CTGTGGTCCAAGAGAGAGGTTGG + Intergenic
937862213 2:126720085-126720107 CTGTGGGCCTTGAGGGAAGTGGG + Intergenic
937996676 2:127699371-127699393 CTGCAGTGCTAGAGGAGAGTGGG + Intergenic
938445214 2:131371352-131371374 CTATAGTGCTAGAGTGGAGTAGG + Intergenic
939510226 2:143095805-143095827 CTATAGTGCTAGAGTGGAGTAGG + Intronic
939752755 2:146067838-146067860 CTGTGGTCCTTGAGAGAAGGAGG + Intergenic
939782162 2:146462675-146462697 CTGTGGTCCCAGAGTGTGGTTGG + Intergenic
939948083 2:148434606-148434628 CTGTGGTCCAGGAGTGGGGTTGG + Intronic
940005596 2:149006915-149006937 CTGTGGTCCTAGGGAGGGTTAGG + Intronic
940492551 2:154382153-154382175 CTGTGTCCATAGAGGGGATTGGG - Intronic
940639495 2:156332271-156332293 CTTTGGCACTAGTGGGGAGTTGG - Intronic
940762063 2:157749730-157749752 CTTGGGCCCTAGAGGTGAGTGGG - Intronic
942405493 2:175649423-175649445 CTGTGGTCCAAGAGAGTGGTTGG - Intergenic
944661095 2:201922622-201922644 CGGTGGTTGTGGAGGGGAGTGGG - Intergenic
945023618 2:205598757-205598779 GTGTGGTCCAAGAGTGCAGTTGG - Intronic
946776275 2:223144892-223144914 CTGTGGTCCTATGGAGGAGCTGG - Intronic
946938241 2:224744034-224744056 CAGTGGTCAAACAGGGGAGTTGG + Intergenic
1172857844 20:38021664-38021686 CTGTGGTCCTGGAAAGTAGTTGG + Intronic
1173671873 20:44804689-44804711 CTCTGGTTCTAGCAGGGAGTGGG + Intronic
1173712033 20:45166776-45166798 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
1174859640 20:54078633-54078655 CTGTGGTTCTAGAGCTGAGGTGG - Intergenic
1174935382 20:54862084-54862106 CTGTTGTCATAGAGAGGAGCTGG + Intergenic
1175022728 20:55868112-55868134 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
1175745063 20:61450813-61450835 CTGTGCTCCAAGAGTGGAGGTGG + Intronic
1176098116 20:63353455-63353477 CTGTGGTCCTAGGGGGGCTGTGG + Intronic
1176098248 20:63353808-63353830 CTGTGGTCCTGGAGGGGCTGTGG + Intronic
1178263559 21:31121749-31121771 CTGGCTTCCTAGAGGGCAGTAGG - Intronic
1179605904 21:42514778-42514800 CTGGGGTGTTAGCGGGGAGTGGG - Intronic
1185188496 22:49417820-49417842 GTGTTATCCTACAGGGGAGTGGG + Intronic
950266246 3:11575213-11575235 CTGTGGTGCGAGAGGGAAGGCGG + Intronic
951071762 3:18337466-18337488 CTGGAGTCCTAGTGGGGAGCTGG - Intronic
951167248 3:19497589-19497611 CTGTGGTCCAAGAGTGTGGTTGG + Intronic
951626586 3:24671267-24671289 CTGTGGTTATAGTGGTGAGTAGG + Intergenic
952269501 3:31817594-31817616 CTGTGGTCTTAGACGGGGCTGGG - Intronic
953025086 3:39140416-39140438 CTGTGGCCCTAGATGGGAGTAGG + Intergenic
953449801 3:42996703-42996725 CTCTGGGCCTAGAGGGGAGATGG - Intronic
956389369 3:68755112-68755134 CTGTGGTGCTAGATTGGAATCGG - Intronic
957923431 3:86777076-86777098 ATGTGGTCATAGAGGGTTGTGGG - Intergenic
959078333 3:101774822-101774844 CTGTGGTGCTGGATTGGAGTTGG + Intergenic
960114352 3:113878658-113878680 CTGTGGTGTTAGATGGGACTTGG - Intronic
961602751 3:128073612-128073634 ATGTGGCCCTAGAAGGGATTGGG - Intronic
961945937 3:130688129-130688151 CTCTGGTGCTAGATAGGAGTTGG - Intronic
962038735 3:131682910-131682932 CTGTGGTCCTAGGGTGGTGGTGG - Intronic
962192110 3:133321821-133321843 CTGTGGTCTGAGAGGGCACTTGG - Intronic
962474021 3:135740123-135740145 CTGTGGTCCCAGAAGGCACTGGG - Intergenic
962909185 3:139832235-139832257 CTGTGGTGCCAGAGGAGCGTCGG - Intergenic
969214362 4:5710655-5710677 CCTTGGTCCTAGTGGGGACTAGG + Intergenic
971606250 4:28661618-28661640 CTGTATCCCCAGAGGGGAGTAGG - Intergenic
974466970 4:62270473-62270495 CTGTGGTTCTAGATGAGACTTGG - Intergenic
974590948 4:63947884-63947906 CTGTGGTCCAAGAGTGTAGTTGG + Intergenic
975896829 4:79103198-79103220 CTGTGGTCCAAGAGTGTAGTTGG + Intergenic
979175934 4:117664055-117664077 CTGTAGTCCCAGAATGGAGTGGG + Intergenic
979359713 4:119747055-119747077 CTGGGATCATAGAGGAGAGTGGG + Intergenic
979994589 4:127415464-127415486 CTGTGGTTCCAGAGTAGAGTTGG - Intergenic
982325851 4:154127557-154127579 CTGTGGCCCTAAATGGGAATAGG - Intergenic
982442571 4:155454098-155454120 CTGTAGTGCTGGAGTGGAGTAGG + Intergenic
982829755 4:160044599-160044621 CTGTTGTACTGGAGTGGAGTAGG + Intergenic
983976168 4:173936918-173936940 CTTTGGGCCTAGAGGGAACTTGG - Intergenic
984124877 4:175795627-175795649 CTGTGGTCCCAGCTGGGAGGAGG + Intronic
985271583 4:188198489-188198511 CTGGGGTCATAGTGGCGAGTTGG - Intergenic
986217698 5:5735863-5735885 CTGTGGTCCAAGAGCGTGGTTGG + Intergenic
986903969 5:12470625-12470647 CTGTGGTCTGAGAGAGCAGTTGG - Intergenic
986909494 5:12536428-12536450 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
988967057 5:36429831-36429853 CTGTGGTCCAAGAGAGTGGTTGG + Intergenic
989716111 5:44465653-44465675 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
992530202 5:77645625-77645647 CCGCGGTCCCAGAGGGGACTCGG + Intergenic
993438750 5:87928713-87928735 CTGTGGTCTGAGAGTGTAGTTGG - Intergenic
993656314 5:90582031-90582053 CTGTGGTCCAAGAGTGTACTTGG + Intronic
994458736 5:100048029-100048051 CTATGGTGCTTGAGTGGAGTAGG + Intergenic
995652990 5:114392378-114392400 CTTTTCTCCTAGAGAGGAGTTGG + Intronic
995753758 5:115480070-115480092 GTGTGATGCTTGAGGGGAGTAGG - Intergenic
995851795 5:116553987-116554009 CTGTATTCCTGGAGAGGAGTGGG + Intronic
997379252 5:133423576-133423598 CTGTGGTCATCGAGGGGTGGTGG + Intronic
997551317 5:134755741-134755763 GTGTTGTCTTAAAGGGGAGTTGG + Intergenic
998106382 5:139471748-139471770 CTGGGGTCCTGGAGGAGAGGGGG - Intergenic
998762659 5:145449593-145449615 CTGTGGTCCTAAATGGGAACAGG - Intergenic
1000064714 5:157684566-157684588 CTGTGGCCCTGGAGAGGAGGAGG - Intergenic
1000171329 5:158705741-158705763 CTGTGGTCCTAGGAAGGAGCAGG - Intronic
1000569867 5:162898501-162898523 CTGTGGTCCCAGAGTGTGGTTGG - Intergenic
1002494019 5:179599654-179599676 CTGTTTTCCCAGAGGGGAGGAGG + Intronic
1005909983 6:30300920-30300942 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
1006315184 6:33287285-33287307 CTGGGGTCCTAAAGGAGAGGTGG + Intronic
1006415749 6:33902963-33902985 CTGTGAGCCCAGAGGGGATTGGG - Intergenic
1006735340 6:36269241-36269263 GTGTGGTCTTTGAGGGGAGCGGG + Intronic
1006904124 6:37521617-37521639 CTGTTGTCCTTCAGGGGAGTGGG + Intergenic
1007250366 6:40491002-40491024 CTGTGGCCATAGAGGGGTGAGGG + Intronic
1007354182 6:41299029-41299051 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
1009805252 6:68594266-68594288 CTGTGGTCCAAGACTGTAGTTGG + Intergenic
1010466143 6:76168434-76168456 CTGTGGTCCAAGAGTGTGGTCGG - Intergenic
1012052608 6:94362548-94362570 CTCTGGGCCTGGAGGGGGGTGGG + Intergenic
1012238549 6:96846190-96846212 CTGTGGTCCAAGAGAGTGGTTGG - Intergenic
1012586611 6:100931007-100931029 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
1012834168 6:104243988-104244010 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
1012945414 6:105460894-105460916 CTGTGGCCCTAAATGGGAATGGG + Intergenic
1014960547 6:127678871-127678893 CTGTGGACCAAGAGTGCAGTTGG + Intergenic
1016237855 6:141889818-141889840 CTGTGGTCTGAGAGTGTAGTTGG - Intergenic
1016829354 6:148418054-148418076 CAGTGGTCCTAGTGGGCACTTGG + Intronic
1019993144 7:4706448-4706470 CTCTGGCCCTAGAGTGGGGTGGG + Intronic
1020425971 7:8066731-8066753 CTGTGGTCCAAGAGTGTGGTTGG + Intronic
1020976626 7:15014455-15014477 ATGAGGTCCTAAAGGGAAGTGGG + Intergenic
1021824484 7:24534963-24534985 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
1022545488 7:31184253-31184275 CTGTGGTTCAAGAGTGTAGTTGG + Intergenic
1024670660 7:51591009-51591031 ATGTCTTCCTAGAGGGGAGGAGG + Intergenic
1028078640 7:86547312-86547334 CTGTGATCCTTTAGGGGAGAAGG + Intergenic
1028217967 7:88158548-88158570 CTGTGGTCCAAGAGTGGGTTTGG - Intronic
1029560962 7:101302784-101302806 CTATGGTCCTAGGTGGGAATGGG - Intergenic
1029798366 7:102920027-102920049 GTGTGTTCATACAGGGGAGTAGG + Intronic
1030972820 7:116081477-116081499 CAGTGGTCATAGAGAAGAGTAGG - Intronic
1033796573 7:144852083-144852105 CTGTGATCCTTGAGGGGTGGGGG - Intergenic
1034269773 7:149797875-149797897 CTGAGCTCCTTGAGGGCAGTGGG + Intergenic
1034851634 7:154499322-154499344 CTGTGCTCCTAGAAGGCAGGGGG - Intronic
1036054961 8:5241412-5241434 CTGTGGTCCAAGAATGTAGTTGG - Intergenic
1036106102 8:5842142-5842164 CAGTGGTCCCAGGGTGGAGTCGG + Intergenic
1036649328 8:10632268-10632290 CTGTGATCCTAGAGTTGAGTTGG + Intronic
1037894716 8:22644231-22644253 CTGTGGGCTTAAAGGGGGGTGGG + Intronic
1038859647 8:31373480-31373502 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
1040760417 8:50835027-50835049 CTGTGGTCCAAGAGAGTGGTTGG - Intergenic
1040977641 8:53212171-53212193 CTGTGGTCCAAGAGAGTGGTTGG + Intergenic
1043727266 8:83626822-83626844 CTGTGGTCCGAGAGTGCATTTGG + Intergenic
1045520163 8:102896523-102896545 CTTTGGTACTGGAGGGGAATTGG - Intronic
1045676320 8:104612058-104612080 CTGTGGTCCAAGAGTGTGGTTGG + Intronic
1046771838 8:118124282-118124304 CTGTTGTCCTATAGGGGAGGTGG - Intergenic
1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG + Intronic
1049086057 8:140479460-140479482 CTGGGGTCCTGGTGGGGGGTGGG + Intergenic
1049115456 8:140682661-140682683 CTGTGGTCCTAGAGTGTGGTTGG - Intronic
1049224455 8:141443159-141443181 CTATGGACCTGCAGGGGAGTTGG - Intergenic
1049326095 8:142022341-142022363 CTGTGGGCCTGGTGGGGGGTCGG - Intergenic
1049570892 8:143369817-143369839 CTGACGTCCCAGAGGGGAGGAGG - Intronic
1051110502 9:13629925-13629947 CTGTGGTCCAAGAGAGCGGTTGG - Intergenic
1051133596 9:13892150-13892172 CTGTGGTCCAAGAGAGTGGTTGG + Intergenic
1053548427 9:39048590-39048612 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
1053812549 9:41868654-41868676 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
1054618046 9:67318785-67318807 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
1058916435 9:109570780-109570802 CTGTGGTCTGAGAGTGTAGTTGG - Intergenic
1060376231 9:123117234-123117256 CTGTAATCCTGGAGGGGAGCAGG - Intronic
1188644606 X:32550279-32550301 CTGTGGTCCAAGAGTGTTGTTGG - Intronic
1189209339 X:39270739-39270761 CTGTGGTCCAAGAGAGTGGTTGG - Intergenic
1189873283 X:45406488-45406510 CTGTGGTCCTAGGGTGAGGTTGG - Intergenic
1191032948 X:55994767-55994789 CTGTGGTCTGAGAGTGTAGTTGG + Intergenic
1192452314 X:71252197-71252219 TTTTGGTTCTAGATGGGAGTGGG - Intronic
1193625056 X:83808853-83808875 CTGTGGTCCAAGAGTGTACTTGG + Intergenic
1193644263 X:84047597-84047619 CAGTGGGCTTGGAGGGGAGTGGG - Intergenic
1194019671 X:88671189-88671211 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
1194344645 X:92748540-92748562 CTGTGGTCCAAGAGAGTGGTTGG + Intergenic
1194404011 X:93471340-93471362 CTGTGGTCCAAGAGTGTATTTGG - Intergenic
1195586378 X:106569595-106569617 CTGTGGTCTGAGAGTGTAGTTGG - Intergenic
1196234085 X:113259239-113259261 CTGTGGTCCAAGAGCGTGGTTGG + Intergenic
1196475077 X:116074346-116074368 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
1196584334 X:117411809-117411831 CTGTGGTCTGAGAGAGTAGTTGG - Intergenic
1196705159 X:118711131-118711153 CTGTGGACGTAGAGGAGAATGGG - Intergenic
1197474438 X:126903282-126903304 CTGTGGTCCAAGAGAATAGTTGG - Intergenic
1199354415 X:146844691-146844713 CTGTGGTCCAAGAGCGTGGTTGG + Intergenic
1199400409 X:147392229-147392251 CTGTGGTCCAAGAGCGTGGTTGG - Intergenic
1199993360 X:153002805-153002827 CTGTGGTCATAAAGGGCATTTGG - Intergenic
1200652991 Y:5865178-5865200 CTGTGGTCCAAGAGAGTGGTTGG + Intergenic