ID: 1160774411

View in Genome Browser
Species Human (GRCh38)
Location 19:848426-848448
Sequence TGCCCAGGGCCACCCTGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160774411_1160774418 16 Left 1160774411 19:848426-848448 CCCCATCAGGGTGGCCCTGGGCA No data
Right 1160774418 19:848465-848487 CGTGCCTCAGTTTCCTCATCTGG No data
1160774411_1160774420 23 Left 1160774411 19:848426-848448 CCCCATCAGGGTGGCCCTGGGCA No data
Right 1160774420 19:848472-848494 CAGTTTCCTCATCTGGAAAATGG 0: 53
1: 1097
2: 4668
3: 10422
4: 17798

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160774411 Original CRISPR TGCCCAGGGCCACCCTGATG GGG (reversed) Intergenic
No off target data available for this crispr