ID: 1160775208

View in Genome Browser
Species Human (GRCh38)
Location 19:852358-852380
Sequence TTTCCTCGCCTGTGTCCTGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 219}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160775197_1160775208 18 Left 1160775197 19:852317-852339 CCCAGCCCCACCATGACCCTCGG 0: 1
1: 0
2: 1
3: 21
4: 214
Right 1160775208 19:852358-852380 TTTCCTCGCCTGTGTCCTGCCGG 0: 1
1: 0
2: 0
3: 17
4: 219
1160775194_1160775208 26 Left 1160775194 19:852309-852331 CCCGGAGCCCCAGCCCCACCATG 0: 1
1: 1
2: 8
3: 103
4: 698
Right 1160775208 19:852358-852380 TTTCCTCGCCTGTGTCCTGCCGG 0: 1
1: 0
2: 0
3: 17
4: 219
1160775202_1160775208 11 Left 1160775202 19:852324-852346 CCACCATGACCCTCGGCCGCCGA 0: 1
1: 0
2: 0
3: 4
4: 62
Right 1160775208 19:852358-852380 TTTCCTCGCCTGTGTCCTGCCGG 0: 1
1: 0
2: 0
3: 17
4: 219
1160775199_1160775208 17 Left 1160775199 19:852318-852340 CCAGCCCCACCATGACCCTCGGC 0: 1
1: 1
2: 2
3: 28
4: 296
Right 1160775208 19:852358-852380 TTTCCTCGCCTGTGTCCTGCCGG 0: 1
1: 0
2: 0
3: 17
4: 219
1160775207_1160775208 -8 Left 1160775207 19:852343-852365 CCGACTCGCGTGTCTTTTCCTCG 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1160775208 19:852358-852380 TTTCCTCGCCTGTGTCCTGCCGG 0: 1
1: 0
2: 0
3: 17
4: 219
1160775206_1160775208 -5 Left 1160775206 19:852340-852362 CCGCCGACTCGCGTGTCTTTTCC 0: 1
1: 0
2: 0
3: 0
4: 43
Right 1160775208 19:852358-852380 TTTCCTCGCCTGTGTCCTGCCGG 0: 1
1: 0
2: 0
3: 17
4: 219
1160775200_1160775208 13 Left 1160775200 19:852322-852344 CCCCACCATGACCCTCGGCCGCC 0: 1
1: 0
2: 1
3: 16
4: 156
Right 1160775208 19:852358-852380 TTTCCTCGCCTGTGTCCTGCCGG 0: 1
1: 0
2: 0
3: 17
4: 219
1160775195_1160775208 25 Left 1160775195 19:852310-852332 CCGGAGCCCCAGCCCCACCATGA 0: 1
1: 0
2: 3
3: 68
4: 617
Right 1160775208 19:852358-852380 TTTCCTCGCCTGTGTCCTGCCGG 0: 1
1: 0
2: 0
3: 17
4: 219
1160775203_1160775208 8 Left 1160775203 19:852327-852349 CCATGACCCTCGGCCGCCGACTC 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1160775208 19:852358-852380 TTTCCTCGCCTGTGTCCTGCCGG 0: 1
1: 0
2: 0
3: 17
4: 219
1160775196_1160775208 19 Left 1160775196 19:852316-852338 CCCCAGCCCCACCATGACCCTCG 0: 1
1: 0
2: 3
3: 39
4: 411
Right 1160775208 19:852358-852380 TTTCCTCGCCTGTGTCCTGCCGG 0: 1
1: 0
2: 0
3: 17
4: 219
1160775205_1160775208 1 Left 1160775205 19:852334-852356 CCTCGGCCGCCGACTCGCGTGTC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1160775208 19:852358-852380 TTTCCTCGCCTGTGTCCTGCCGG 0: 1
1: 0
2: 0
3: 17
4: 219
1160775204_1160775208 2 Left 1160775204 19:852333-852355 CCCTCGGCCGCCGACTCGCGTGT 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1160775208 19:852358-852380 TTTCCTCGCCTGTGTCCTGCCGG 0: 1
1: 0
2: 0
3: 17
4: 219
1160775193_1160775208 27 Left 1160775193 19:852308-852330 CCCCGGAGCCCCAGCCCCACCAT 0: 1
1: 0
2: 12
3: 52
4: 509
Right 1160775208 19:852358-852380 TTTCCTCGCCTGTGTCCTGCCGG 0: 1
1: 0
2: 0
3: 17
4: 219
1160775201_1160775208 12 Left 1160775201 19:852323-852345 CCCACCATGACCCTCGGCCGCCG 0: 1
1: 0
2: 0
3: 7
4: 71
Right 1160775208 19:852358-852380 TTTCCTCGCCTGTGTCCTGCCGG 0: 1
1: 0
2: 0
3: 17
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160775208 Original CRISPR TTTCCTCGCCTGTGTCCTGC CGG Exonic
905803523 1:40860928-40860950 TTTCCTCTCCTGGGCACTGCTGG + Intergenic
905894756 1:41538291-41538313 TGCCCTCGCCTCTGTCCAGCTGG - Intronic
905956850 1:42004147-42004169 TTTCCTCTCCTCTTTCCTCCTGG - Intronic
906144106 1:43550027-43550049 TCTCCTGTGCTGTGTCCTGCGGG + Intronic
906321655 1:44821041-44821063 TTTCCTGGCCTTTGTCCAGGTGG + Intronic
906692701 1:47803120-47803142 TCTCCTCGGCTGTCTCCTCCAGG + Intronic
907516606 1:54997085-54997107 TTTCCTCGCCTGTGAAATGCGGG + Intergenic
911879730 1:103221032-103221054 TTTCTTGGCATTTGTCCTGCTGG + Intergenic
912023788 1:105140638-105140660 TTTCCCTGCCTGTTTCCTTCAGG - Intergenic
912379307 1:109238619-109238641 TCTCCTCTCCTCTGCCCTGCTGG - Intergenic
914965444 1:152253442-152253464 TTTCCTCACCGCTGTCCTTCAGG + Intergenic
915599212 1:156912252-156912274 TTTTCTCCCCAGTGTCCTGGAGG - Exonic
919409131 1:197222157-197222179 AGTGCTTGCCTGTGTCCTGCCGG + Intergenic
922237277 1:223731553-223731575 TTTCCACGTCTGTCTCCTGCCGG + Intronic
922369831 1:224898214-224898236 TTTCCTGGCCTGATTGCTGCAGG + Intronic
922776605 1:228216991-228217013 TGACCCAGCCTGTGTCCTGCAGG + Exonic
923934602 1:238747058-238747080 TTTCCTTTCCTGAGTCCTGGTGG - Intergenic
924260752 1:242228389-242228411 TTTCCCATTCTGTGTCCTGCGGG - Intronic
924926005 1:248681604-248681626 TTTGCTCGACTCTGTCCTGAAGG + Exonic
1063524552 10:6772796-6772818 TTTCCCAACCTGTGGCCTGCGGG - Intergenic
1063859138 10:10289587-10289609 TTTCCTTGCTTGTTTCCTTCTGG + Intergenic
1064168276 10:13005163-13005185 TTTCTTCACCAGTGTCCTTCAGG + Intronic
1064966591 10:21020780-21020802 GTTCCTTCCCTGTCTCCTGCAGG + Intronic
1067408775 10:46046763-46046785 CTTGCTCTCCTGTGCCCTGCAGG - Intergenic
1067498942 10:46785258-46785280 CTCCCTCGCCTGGCTCCTGCAGG - Intergenic
1067595700 10:47555115-47555137 CTCCCTCGCCTGGCTCCTGCAGG + Intergenic
1069850975 10:71404774-71404796 TTTTCTAGCCTGTGTCTTCCTGG + Intronic
1069870020 10:71527351-71527373 ATTCCCTCCCTGTGTCCTGCTGG - Intronic
1070338224 10:75473675-75473697 TTTCCTCATCTGTGGCATGCTGG + Intronic
1070834394 10:79438774-79438796 TCTCCTCTGCTTTGTCCTGCTGG - Intronic
1072090492 10:92122161-92122183 TTTTCTCCCCAGTGTCCTGTAGG - Intronic
1073328930 10:102658409-102658431 TTTGCTCCCCTGGGTCCAGCTGG + Intergenic
1073545553 10:104345681-104345703 TTACCTCTCCTCTGTGCTGCTGG - Intergenic
1075548767 10:123376734-123376756 CTTCCACGCCTCTGCCCTGCAGG - Intergenic
1075892627 10:125966533-125966555 ATACCTCTCCTGTGTCCTGAGGG - Intronic
1076241988 10:128915568-128915590 CTTGCTCCCCTGTGGCCTGCCGG - Intergenic
1076758372 10:132587249-132587271 GTTCCTCACCTGTTACCTGCTGG + Intronic
1076866796 10:133170403-133170425 CTGCCACGCCTGTGTCCTGCAGG - Intronic
1077888835 11:6404757-6404779 TTTCCTGGCCATTATCCTGCAGG - Intronic
1078469880 11:11578264-11578286 TTTGCTAGCCAGTGACCTGCAGG - Intronic
1081989087 11:47328006-47328028 TGTACTCGCCTGTCTTCTGCTGG + Intronic
1082903893 11:58285345-58285367 CTGCCTCTACTGTGTCCTGCAGG - Intergenic
1083448737 11:62728179-62728201 TTTCCTCTCCTTGCTCCTGCTGG + Intronic
1083596432 11:63920095-63920117 TTTCCTTGCCTGTCTCTGGCTGG + Intergenic
1084016909 11:66389097-66389119 TTTCCACACCTGGGTCCTGCAGG - Intergenic
1084588230 11:70075795-70075817 TGTCCCCGCCTGTGTCCTATGGG - Intergenic
1086005478 11:82030588-82030610 TCGCATCGCCTGTGACCTGCAGG + Intergenic
1088978198 11:114834451-114834473 TTTCTTCACCTCTGTCCTCCTGG + Intergenic
1092689270 12:11088858-11088880 TTTGCTCTCCTGTCTCCTACAGG - Intronic
1094320005 12:29173296-29173318 TTTCCTTGCTTGTTTCCTTCTGG + Intronic
1094338145 12:29383635-29383657 TTTCCTTGCTTGTTTCCTTCTGG + Intergenic
1095535267 12:43238498-43238520 TTTCCTGGGCTGTGTGCTGCAGG + Intergenic
1095648262 12:44575992-44576014 TTTCCTGGCCTCTGTGCTCCAGG + Intronic
1096219634 12:49820968-49820990 TCTTCTCTCCTGTGCCCTGCAGG - Intronic
1096472684 12:51889147-51889169 TGTCCCCTCCTTTGTCCTGCTGG - Exonic
1096590729 12:52657566-52657588 TTTCCTCCCCTGTGGACTGAGGG + Intergenic
1097967366 12:65595428-65595450 TTTCCTTCCCTGGGACCTGCTGG - Intergenic
1099100948 12:78439704-78439726 TTTCCTCTCCTCTCTCCTCCAGG + Intergenic
1103565629 12:121814108-121814130 TGTCCTCGCCTGAGGACTGCTGG - Exonic
1103884239 12:124188940-124188962 CTTGCTCGCATGAGTCCTGCTGG + Intronic
1103931798 12:124454509-124454531 CTTCCTCGCCTGTGTTCCTCGGG + Intronic
1105314436 13:19244216-19244238 TTGCCTCCGCTGTGTCATGCAGG - Intergenic
1106289777 13:28350116-28350138 TTTCCACTCCTGTGTGCTGCTGG - Intronic
1106411957 13:29516881-29516903 TCTCTTGGCCTGTGTCATGCAGG + Intronic
1106509600 13:30401543-30401565 TTTCCTCCCCTGTCCCCTGCAGG - Intergenic
1110748077 13:79079481-79079503 CTGCCTCTCCTGTGTCATGCAGG - Intergenic
1111729262 13:92052485-92052507 TGTCCCCGCCCATGTCCTGCTGG + Intronic
1113362155 13:109641414-109641436 TTTCCTCTCCTTTTTCCAGCTGG + Intergenic
1117768462 14:59107744-59107766 TTGCCTCTGCTGTGTCGTGCAGG - Intergenic
1118801964 14:69198495-69198517 TTTGCTCTCCAGTGTCCTGTAGG + Intronic
1121931673 14:97978032-97978054 TTTCCTCTCCGGTTTCCTCCGGG + Exonic
1122362056 14:101173390-101173412 TTTCCTTGTCTGTTTCCTGGAGG + Intergenic
1122677315 14:103426469-103426491 CTTCTGGGCCTGTGTCCTGCAGG + Intronic
1122908802 14:104816237-104816259 TTTCCTCGCCTTTGTGTCGCGGG + Intergenic
1126214949 15:46144019-46144041 TTTCCTAGCCTGTTTCTTGAGGG + Intergenic
1127194455 15:56568792-56568814 TTTTCTCTCCTGTGTCATGCAGG - Intergenic
1129197849 15:73981794-73981816 CTTCCTCCCCTGTGGACTGCAGG + Exonic
1131481871 15:92789115-92789137 TGTCCCCGCCCATGTCCTGCTGG + Intronic
1132236319 15:100224608-100224630 TTTCCTCGCCTTTGCACTGGGGG - Intronic
1133336313 16:5008768-5008790 TTTCCTCTGCCCTGTCCTGCAGG - Intronic
1134485692 16:14656582-14656604 TCTCCTTGCCTGTTTCCTCCTGG + Intronic
1135503859 16:23019766-23019788 TATCATCGCCTCTTTCCTGCAGG + Intergenic
1140691936 16:77492944-77492966 TGTCCTCACCTGTCTCCTACAGG - Intergenic
1141924297 16:87157226-87157248 TTTCTGTGCCTGTGTCCTCCAGG - Intronic
1142590554 17:1003749-1003771 TTTCTTAGCCTGACTCCTGCTGG + Exonic
1142995229 17:3756095-3756117 TTTCCTCGTCTGTGAGCTCCTGG + Intronic
1143504478 17:7356174-7356196 TTGCCTCTGCTGTCTCCTGCAGG + Exonic
1143702388 17:8670915-8670937 TTTCCTCACCTTTGTGCTTCGGG - Intergenic
1144519694 17:15945485-15945507 CTTCCTCGCCTGCTTCGTGCTGG + Exonic
1144946019 17:18969840-18969862 CTCCCTGGCCTTTGTCCTGCAGG - Exonic
1145253832 17:21311978-21312000 CTTTCTCGCCTTTGTTCTGCTGG + Intronic
1146482928 17:33219619-33219641 TTTCCCAAACTGTGTCCTGCGGG + Intronic
1146508850 17:33428577-33428599 TTTCCTTCCCTGTGTCCTAAGGG - Intronic
1147267518 17:39243898-39243920 TTTCCGCTCCTTTGTGCTGCAGG - Intergenic
1147949929 17:44101643-44101665 TTTCCTCACCTGTGTCTTGAGGG - Intronic
1148397481 17:47321436-47321458 TTTTCTCGCCTGTGTTCTTGAGG - Intronic
1148667558 17:49386271-49386293 TGTCCTCTCCTGTGCCCTCCTGG + Intronic
1148907957 17:50923134-50923156 TTTCCTCCTCTGTGGCCTGTGGG - Intergenic
1150222164 17:63501771-63501793 ATTCCCCACCTGTGTCCTCCAGG + Intronic
1152859804 17:82689527-82689549 CCACCTCGCCTGTGTCCTGCAGG - Intronic
1154292827 18:13125423-13125445 TTTCCCTCCCTGTATCCTGCTGG - Intergenic
1158168065 18:54564315-54564337 TTTTCTTGCCTGTGGCTTGCAGG - Intergenic
1160014433 18:75129441-75129463 TTTCACAGCCTTTGTCCTGCTGG - Intergenic
1160026646 18:75223543-75223565 TTTCCTGGCCTGTCTTCTCCAGG + Intronic
1160103790 18:75949254-75949276 TTTCCTCTCCTATTCCCTGCAGG - Intergenic
1160775208 19:852358-852380 TTTCCTCGCCTGTGTCCTGCCGG + Exonic
1161167925 19:2798448-2798470 TTTCCGCGCTTCTGTCCTCCAGG - Intronic
1161290516 19:3491376-3491398 TGTCATCGCTTGTGTCTTGCTGG - Exonic
1164801689 19:31081919-31081941 GTTACTCGCCAGTGCCCTGCCGG - Intergenic
1164861151 19:31563310-31563332 TTTTCTCGCTTGCGTTCTGCAGG - Intergenic
1168382391 19:55934956-55934978 TTTACTCCACTGTATCCTGCTGG - Intergenic
926731884 2:16041795-16041817 TTTCCCTGCCACTGTCCTGCTGG - Intergenic
928200029 2:29241930-29241952 TTTCCTCCCCAATGTGCTGCTGG + Intronic
928388661 2:30891139-30891161 TTTCCTCCCATGTCTCATGCCGG - Intergenic
931686684 2:64800027-64800049 TTTCCTGGCCTGTGTCCAGAAGG + Intergenic
931715852 2:65028072-65028094 TTTCCTCATCTGTGAACTGCGGG + Intergenic
932384910 2:71323418-71323440 CTGCCTCTCCTGTGTCATGCAGG + Intronic
932577474 2:72970635-72970657 TTTCCCAGCCTTTGTCCTGATGG - Intronic
932770682 2:74499272-74499294 TTTCCTCACCTCTCTCCTCCTGG - Intronic
933684454 2:85132852-85132874 TTTCCGCGCCTTTTTCCTGTGGG - Intergenic
935007111 2:99089658-99089680 CTGCCTCTCCTGTGTCATGCAGG - Intronic
935549268 2:104434655-104434677 TTGCCACGGCTGTGCCCTGCAGG - Intergenic
936520443 2:113208973-113208995 TTCTCTGGGCTGTGTCCTGCAGG - Intronic
939777673 2:146406294-146406316 TTTGTTCGTCTGTGCCCTGCCGG - Intergenic
941806649 2:169716905-169716927 TTACCTGTGCTGTGTCCTGCAGG + Intronic
942824145 2:180153621-180153643 TTTACTTGCCTGTGTCCTTTTGG + Intergenic
944524961 2:200609585-200609607 TTTCTTCCCCTGTGTCTTTCTGG + Intronic
946499252 2:220228412-220228434 ATTCCTCTCCTGTGTCCTGGGGG + Intergenic
946893854 2:224303143-224303165 CTTCCGAGCCCGTGTCCTGCTGG + Intergenic
947442413 2:230134621-230134643 TTTCCTGGGCTGGGTGCTGCAGG + Intergenic
947568584 2:231212810-231212832 GTCCCTCGCCTGTGTCCGGGAGG + Intronic
948158911 2:235808286-235808308 TTTGCTCTCCTCTCTCCTGCGGG + Intronic
1169350113 20:4861939-4861961 TTTCCTCACCTGTGACCAGAGGG + Exonic
1171042567 20:21778982-21779004 TCTCCTGGCCAGTGTCCTGTGGG - Intergenic
1171387802 20:24781854-24781876 TTTCCTCACCTGTGTAATGAGGG - Intergenic
1172785259 20:37464453-37464475 GTCCCTTGCCTGTGTCCTCCCGG + Intergenic
1174184628 20:48697925-48697947 TGTCCTTGCCTGGGTCATGCAGG - Intronic
1174200020 20:48800579-48800601 TTTCCTCGTCTGTGACATGAGGG - Intronic
1175397152 20:58673501-58673523 TTTCCTTCCCTGTGTGCTGCAGG - Intronic
1176253361 20:64137768-64137790 TTTCCACCTCTGTGACCTGCAGG - Intergenic
1179124341 21:38577931-38577953 TTCCCTCTGCTGTGTTCTGCAGG - Intronic
1183457682 22:37931672-37931694 TCTCTTTGCCTGGGTCCTGCTGG + Intronic
1183673954 22:39289621-39289643 GTGCCTTGCCTGTCTCCTGCAGG + Intergenic
1184119245 22:42439778-42439800 TTTGGTCACCTGTGACCTGCTGG - Intergenic
1184747738 22:46465802-46465824 TTTCCTCACCTGTGAACTGGGGG - Intronic
1185207048 22:49545897-49545919 TCTTCCTGCCTGTGTCCTGCAGG + Intronic
1185254829 22:49826528-49826550 CTTCCCCGCCTGTGGCCCGCAGG - Intronic
1185398743 22:50605336-50605358 CTCCCCCGCCTCTGTCCTGCCGG + Intronic
952728895 3:36618703-36618725 CTTCCTCTCCTGTGTTCTGGAGG - Intergenic
953410056 3:42685711-42685733 GTTCCTCGACTGTGTGGTGCGGG + Exonic
953736552 3:45498802-45498824 TTTCCTCTCCAGTGTCCTTTAGG + Intronic
955493656 3:59508571-59508593 TATTCCCGCCTGTGTCCTCCAGG + Intergenic
955596283 3:60594382-60594404 TTTCCTCGACTGGTTTCTGCAGG - Intronic
959875020 3:111372691-111372713 CTCCCTTGCCTGTGTCCAGCAGG - Intronic
961309054 3:125981848-125981870 TCTCCTCTACTGTGTCTTGCTGG + Intronic
961607135 3:128104663-128104685 TTTCCTGACCTGTGCACTGCAGG - Intronic
961637466 3:128342390-128342412 TTTCCTCACCTGTGGACTGAGGG + Intronic
961637479 3:128342437-128342459 TTTCCTCACCTGTGGACTGAGGG + Intronic
965062688 3:163803698-163803720 TTTCTTCGCTTGTTTCCTTCTGG - Intergenic
966143531 3:176784550-176784572 TTTCATTGCCTGTGCCATGCAGG - Intergenic
966465312 3:180225231-180225253 TTTCCTGTAATGTGTCCTGCAGG + Intergenic
966819027 3:183910577-183910599 TTTCCTCGCCTGTCAAATGCAGG - Intergenic
967256581 3:187598994-187599016 TTTCCTTTCCTGTTTCATGCTGG + Intergenic
967834282 3:193947645-193947667 TTTCCTCGCTCTTGTCCTCCAGG - Intergenic
968046850 3:195629125-195629147 TGTTCTCGCCTGGCTCCTGCCGG + Intergenic
968307804 3:197660919-197660941 TGTTCTCGCCTGGCTCCTGCCGG - Intergenic
968461972 4:730699-730721 TTTCCGCACCTGTGAACTGCCGG + Intronic
968577371 4:1374190-1374212 TGTCCTCCCCTGTGGGCTGCCGG - Intronic
969581560 4:8068457-8068479 TTGCCACACCTCTGTCCTGCTGG - Intronic
971068819 4:23066936-23066958 CTTTCTCTCCTGTATCCTGCTGG + Intergenic
971372486 4:26029727-26029749 TTTTGTGGCCTGTGTCGTGCTGG + Intergenic
978282275 4:107033671-107033693 TTTCCTTCCCTGTGTCCTTGGGG + Intronic
980304304 4:131037315-131037337 TTTCCTTACTTATGTCCTGCAGG + Intergenic
983531249 4:168811936-168811958 TACCCTCGCCTGTTTCCTGAAGG + Intronic
984987443 4:185345170-185345192 TTTCCTCGTCTGTGGACTGATGG + Intronic
991165794 5:63564588-63564610 TTTCCTTCCCTGAGTCCTGGTGG - Intergenic
992422781 5:76623348-76623370 TTTGCTCTCCTGTGCCGTGCAGG + Exonic
992944710 5:81798715-81798737 TCTCCCCGCCTGGGCCCTGCTGG - Intergenic
995321576 5:110840513-110840535 TTTCCTCTCCTGTGTTGTGACGG + Intergenic
996543089 5:124649697-124649719 TTTCATCCCCTGCCTCCTGCAGG - Exonic
997765745 5:136501496-136501518 TTGCCTCTACTGTGTCATGCAGG + Intergenic
998494332 5:142574247-142574269 TTTCCACGCTTCTGTCCTACAGG + Intergenic
999551605 5:152693620-152693642 TTTCCTCACCTGTTACCTGAGGG - Intergenic
1000396938 5:160785803-160785825 TTTTCTGTCCTGTGTCGTGCAGG - Exonic
1001566293 5:172701570-172701592 CTTTCTTGCCTCTGTCCTGCTGG + Intergenic
1003126877 6:3362774-3362796 CTTCCTCTCCTGGGTCCTGGAGG - Intronic
1003824777 6:9941478-9941500 TTTCATCACCCGTGTTCTGCTGG - Intronic
1004015312 6:11726902-11726924 GTTCCTCGCCTGGGCCCTGCTGG + Intronic
1004793783 6:19058548-19058570 TTTTCTCCCCTGTTTACTGCGGG + Intergenic
1004919809 6:20366065-20366087 TTTCCTCGTCTGATTGCTGCTGG - Intergenic
1005358299 6:25006593-25006615 GTTCATCCCCTGTGTCCTCCAGG + Intronic
1005822534 6:29609379-29609401 CTTCCTCCCCTGTGCCATGCAGG - Exonic
1008512872 6:52293227-52293249 TTTCCTGGCCTCTGTCCATCTGG + Intergenic
1011053095 6:83175654-83175676 TTTCCTCTCCTATGGCCAGCCGG + Intronic
1012006794 6:93722602-93722624 TTTCCTCGCTTCTTTTCTGCAGG - Intergenic
1014144960 6:117987105-117987127 TTTGTTTGCCTCTGTCCTGCAGG + Intronic
1014982098 6:127956715-127956737 TTTCCTGGCTGGTGTCCTTCAGG + Intergenic
1018048455 6:159986101-159986123 GCTCCTCTCCTGTGTCCCGCTGG + Intronic
1019698663 7:2461543-2461565 GTGCCTCGCCTGTGCCTTGCTGG + Intergenic
1020074467 7:5248622-5248644 TTGCCACGGCTGTGACCTGCAGG - Intergenic
1020382941 7:7566460-7566482 TCTCCTTGCCTGTTTCCTGCCGG + Intergenic
1024561297 7:50647745-50647767 TTTCCTTGCCTGTGTCGTCATGG - Intronic
1024930193 7:54661011-54661033 ATCCCCTGCCTGTGTCCTGCAGG - Intergenic
1025204634 7:56985185-56985207 TTGCCACGGCTGTGGCCTGCAGG + Intergenic
1025667303 7:63591750-63591772 TTGCCACGGCTGTGGCCTGCAGG - Intergenic
1029284129 7:99454490-99454512 TTTTCTCGGGTGTGCCCTGCAGG - Intronic
1029360993 7:100088765-100088787 TGTCCCCGCCTGTCGCCTGCGGG - Intergenic
1029507547 7:100971444-100971466 TTACCTCGAAGGTGTCCTGCAGG - Intronic
1030273080 7:107690925-107690947 TCTCTTCGACTGTGTCCTGCTGG - Intronic
1031612771 7:123846387-123846409 TTGCCTCTGCTGTGTCATGCAGG + Intronic
1033451607 7:141466991-141467013 TTGCCTTGGCTGTGTCCTACAGG + Intronic
1035482554 7:159198887-159198909 GAGCCTCGCCTGGGTCCTGCAGG + Intergenic
1045055020 8:98361463-98361485 TTTCCTCATCTGTGGCATGCAGG + Intergenic
1045770807 8:105737702-105737724 ATTCCTCACCTGTGTGCTTCAGG + Intronic
1049555427 8:143279089-143279111 AGTCCACGCCTGGGTCCTGCCGG - Intergenic
1050298153 9:4227888-4227910 TTTCTTTGCCTGTGTCCCTCGGG - Intronic
1050781430 9:9341494-9341516 TTTCCTGGCACTTGTCCTGCTGG + Intronic
1052983353 9:34465616-34465638 TTTCCTCCCCTGTGTACTAGGGG + Intronic
1053475724 9:38380938-38380960 TTTCCTCTCCTGTGCTCTCCAGG + Intergenic
1053505605 9:38640953-38640975 TTTACACGCCTGTGGACTGCAGG + Intergenic
1056935958 9:90914854-90914876 TTTCCTTCCCTCTGTCCTTCTGG - Intergenic
1058254001 9:102738040-102738062 TTTCCTCAGCTGTGTTCTGACGG - Intergenic
1060007615 9:120014393-120014415 TGACCTCTTCTGTGTCCTGCAGG - Intergenic
1060194712 9:121616183-121616205 CTCCCTCGCCTGCATCCTGCAGG - Intronic
1061594332 9:131619206-131619228 TCTCCTCCCCTCTGTCCAGCAGG - Intronic
1061778007 9:132978807-132978829 GTCCCTCGCCTGGGTTCTGCCGG - Exonic
1062168879 9:135123141-135123163 TATCCACTCCTGTGTCTTGCAGG - Intergenic
1062563532 9:137152486-137152508 TTTTCTCTCCCGTGTCCTGTTGG - Intronic
1203785799 EBV:126798-126820 TTCCCTCGGTGGTGTCCTGCCGG + Intergenic
1187238211 X:17488025-17488047 TCTCCTCACCTGTATCCTGCCGG + Intronic
1188933626 X:36146196-36146218 TTTACACTCCTGTCTCCTGCAGG - Intergenic
1189600153 X:42615568-42615590 CTTCCTCTGCTGTGTCATGCAGG + Intergenic
1190063558 X:47225704-47225726 TGTCCTCACCTCTGTCCTGAGGG + Intronic
1192713830 X:73618515-73618537 TTGCCTCTGCTGTGTCATGCAGG + Intronic
1192970279 X:76221328-76221350 CTGCCTCGGCTGAGTCCTGCAGG + Intergenic
1196399644 X:115300485-115300507 TTTTCTAACCTGTGGCCTGCAGG - Intronic
1197463409 X:126771570-126771592 TTGCCTCTGCTGTGTCATGCAGG - Intergenic