ID: 1160775487

View in Genome Browser
Species Human (GRCh38)
Location 19:853258-853280
Sequence GCAGAAACGTCCGCGCGGTG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 24
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 22}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160775477_1160775487 -4 Left 1160775477 19:853239-853261 CCCCGCCTCTCCCTCCCCGGCAG 0: 1
1: 0
2: 5
3: 65
4: 682
Right 1160775487 19:853258-853280 GCAGAAACGTCCGCGCGGTGCGG 0: 1
1: 0
2: 0
3: 1
4: 22
1160775478_1160775487 -5 Left 1160775478 19:853240-853262 CCCGCCTCTCCCTCCCCGGCAGA 0: 1
1: 0
2: 5
3: 89
4: 2056
Right 1160775487 19:853258-853280 GCAGAAACGTCCGCGCGGTGCGG 0: 1
1: 0
2: 0
3: 1
4: 22
1160775471_1160775487 13 Left 1160775471 19:853222-853244 CCGGGGCCGCCCCTGAGCCCCGC 0: 1
1: 1
2: 9
3: 52
4: 540
Right 1160775487 19:853258-853280 GCAGAAACGTCCGCGCGGTGCGG 0: 1
1: 0
2: 0
3: 1
4: 22
1160775467_1160775487 20 Left 1160775467 19:853215-853237 CCGACCCCCGGGGCCGCCCCTGA 0: 1
1: 1
2: 2
3: 19
4: 300
Right 1160775487 19:853258-853280 GCAGAAACGTCCGCGCGGTGCGG 0: 1
1: 0
2: 0
3: 1
4: 22
1160775480_1160775487 -9 Left 1160775480 19:853244-853266 CCTCTCCCTCCCCGGCAGAAACG 0: 1
1: 0
2: 2
3: 25
4: 346
Right 1160775487 19:853258-853280 GCAGAAACGTCCGCGCGGTGCGG 0: 1
1: 0
2: 0
3: 1
4: 22
1160775469_1160775487 15 Left 1160775469 19:853220-853242 CCCCGGGGCCGCCCCTGAGCCCC 0: 1
1: 0
2: 7
3: 55
4: 507
Right 1160775487 19:853258-853280 GCAGAAACGTCCGCGCGGTGCGG 0: 1
1: 0
2: 0
3: 1
4: 22
1160775470_1160775487 14 Left 1160775470 19:853221-853243 CCCGGGGCCGCCCCTGAGCCCCG 0: 1
1: 0
2: 7
3: 38
4: 503
Right 1160775487 19:853258-853280 GCAGAAACGTCCGCGCGGTGCGG 0: 1
1: 0
2: 0
3: 1
4: 22
1160775474_1160775487 3 Left 1160775474 19:853232-853254 CCCTGAGCCCCGCCTCTCCCTCC 0: 1
1: 1
2: 7
3: 94
4: 780
Right 1160775487 19:853258-853280 GCAGAAACGTCCGCGCGGTGCGG 0: 1
1: 0
2: 0
3: 1
4: 22
1160775473_1160775487 4 Left 1160775473 19:853231-853253 CCCCTGAGCCCCGCCTCTCCCTC 0: 1
1: 1
2: 17
3: 164
4: 1325
Right 1160775487 19:853258-853280 GCAGAAACGTCCGCGCGGTGCGG 0: 1
1: 0
2: 0
3: 1
4: 22
1160775468_1160775487 16 Left 1160775468 19:853219-853241 CCCCCGGGGCCGCCCCTGAGCCC 0: 1
1: 0
2: 6
3: 46
4: 454
Right 1160775487 19:853258-853280 GCAGAAACGTCCGCGCGGTGCGG 0: 1
1: 0
2: 0
3: 1
4: 22
1160775475_1160775487 2 Left 1160775475 19:853233-853255 CCTGAGCCCCGCCTCTCCCTCCC 0: 1
1: 1
2: 16
3: 128
4: 1268
Right 1160775487 19:853258-853280 GCAGAAACGTCCGCGCGGTGCGG 0: 1
1: 0
2: 0
3: 1
4: 22
1160775479_1160775487 -6 Left 1160775479 19:853241-853263 CCGCCTCTCCCTCCCCGGCAGAA 0: 1
1: 0
2: 2
3: 63
4: 582
Right 1160775487 19:853258-853280 GCAGAAACGTCCGCGCGGTGCGG 0: 1
1: 0
2: 0
3: 1
4: 22
1160775465_1160775487 22 Left 1160775465 19:853213-853235 CCCCGACCCCCGGGGCCGCCCCT 0: 1
1: 0
2: 8
3: 31
4: 435
Right 1160775487 19:853258-853280 GCAGAAACGTCCGCGCGGTGCGG 0: 1
1: 0
2: 0
3: 1
4: 22
1160775466_1160775487 21 Left 1160775466 19:853214-853236 CCCGACCCCCGGGGCCGCCCCTG 0: 1
1: 0
2: 3
3: 44
4: 448
Right 1160775487 19:853258-853280 GCAGAAACGTCCGCGCGGTGCGG 0: 1
1: 0
2: 0
3: 1
4: 22
1160775472_1160775487 7 Left 1160775472 19:853228-853250 CCGCCCCTGAGCCCCGCCTCTCC 0: 1
1: 3
2: 14
3: 98
4: 899
Right 1160775487 19:853258-853280 GCAGAAACGTCCGCGCGGTGCGG 0: 1
1: 0
2: 0
3: 1
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160775487 Original CRISPR GCAGAAACGTCCGCGCGGTG CGG Exonic
900894442 1:5473499-5473521 GCAGACACCTTCGCGGGGTGAGG - Intergenic
903891295 1:26572151-26572173 GCAGAAAAGCCCGCACGGTCTGG - Intronic
1062835903 10:635563-635585 GCAGAAGCGGCCGCGCAGTGTGG + Intronic
1072792109 10:98325754-98325776 GCAGACACGTCAGCTGGGTGAGG + Intergenic
1075263105 10:120979834-120979856 GCAGGAACGGCCGGGCGGGGCGG - Intergenic
1075730408 10:124632163-124632185 GCAGAAACGTCGCCACCGTGTGG - Intronic
1078637440 11:13065275-13065297 GCAGAAAGGTCAGAGCAGTGCGG + Intergenic
1084056717 11:66638704-66638726 TCAGAAGCGTCCGCGCCGCGAGG + Intronic
1090709979 11:129375543-129375565 GCAGGAGTGTGCGCGCGGTGCGG - Intergenic
1103626813 12:122226215-122226237 GCCGGAACTTCCGCGCGGGGCGG + Exonic
1106956112 13:34941769-34941791 GCAGAAACAAACGCGCGGGGGGG - Intergenic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1124952554 15:34337428-34337450 GCAGAAAGGTCCTCGGGGTCTGG + Exonic
1142711526 17:1726350-1726372 GCGGACACGTCCGCGCGCAGTGG + Exonic
1160775487 19:853258-853280 GCAGAAACGTCCGCGCGGTGCGG + Exonic
1163287217 19:16356211-16356233 GCAGAATTGTCTGCGCCGTGGGG - Intronic
1168274918 19:55272380-55272402 GCAGAAAAGGCCTCACGGTGTGG + Intronic
945102547 2:206275093-206275115 GCAGAAAGGGACGCGGGGTGGGG - Intronic
945569973 2:211454863-211454885 GCAGAACCGTCCTGGCGGGGAGG - Intronic
984943637 4:184954673-184954695 GCAGAAACGTGCGCACGCAGAGG - Intergenic
997416672 5:133733936-133733958 GCAGAAACGTCCACATGGGGAGG - Intergenic
1036727941 8:11236855-11236877 ATAGAAAGGTCCGCGTGGTGAGG + Intergenic
1045474785 8:102543477-102543499 GCAGAAACTTGCACCCGGTGGGG + Intergenic
1062564192 9:137156661-137156683 GCAGCATCGTCCTCGCTGTGGGG - Exonic