ID: 1160777599

View in Genome Browser
Species Human (GRCh38)
Location 19:863085-863107
Sequence GGCCCCCGGAGTCACCCTGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 1, 2: 3, 3: 20, 4: 183}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160777599_1160777612 20 Left 1160777599 19:863085-863107 CCGGCAGGGTGACTCCGGGGGCC 0: 1
1: 1
2: 3
3: 20
4: 183
Right 1160777612 19:863128-863150 CTCGAGGGCGTGGTCACCTCGGG 0: 1
1: 0
2: 0
3: 6
4: 68
1160777599_1160777608 4 Left 1160777599 19:863085-863107 CCGGCAGGGTGACTCCGGGGGCC 0: 1
1: 1
2: 3
3: 20
4: 183
Right 1160777608 19:863112-863134 GGTGTGCGGGGGCGTGCTCGAGG 0: 1
1: 0
2: 0
3: 29
4: 995
1160777599_1160777610 10 Left 1160777599 19:863085-863107 CCGGCAGGGTGACTCCGGGGGCC 0: 1
1: 1
2: 3
3: 20
4: 183
Right 1160777610 19:863118-863140 CGGGGGCGTGCTCGAGGGCGTGG 0: 1
1: 0
2: 3
3: 26
4: 326
1160777599_1160777611 19 Left 1160777599 19:863085-863107 CCGGCAGGGTGACTCCGGGGGCC 0: 1
1: 1
2: 3
3: 20
4: 183
Right 1160777611 19:863127-863149 GCTCGAGGGCGTGGTCACCTCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1160777599_1160777603 -9 Left 1160777599 19:863085-863107 CCGGCAGGGTGACTCCGGGGGCC 0: 1
1: 1
2: 3
3: 20
4: 183
Right 1160777603 19:863099-863121 CCGGGGGCCCGCTGGTGTGCGGG 0: 1
1: 0
2: 0
3: 21
4: 172
1160777599_1160777601 -10 Left 1160777599 19:863085-863107 CCGGCAGGGTGACTCCGGGGGCC 0: 1
1: 1
2: 3
3: 20
4: 183
Right 1160777601 19:863098-863120 TCCGGGGGCCCGCTGGTGTGCGG 0: 1
1: 0
2: 1
3: 11
4: 143
1160777599_1160777604 -8 Left 1160777599 19:863085-863107 CCGGCAGGGTGACTCCGGGGGCC 0: 1
1: 1
2: 3
3: 20
4: 183
Right 1160777604 19:863100-863122 CGGGGGCCCGCTGGTGTGCGGGG 0: 1
1: 0
2: 1
3: 8
4: 170
1160777599_1160777605 -7 Left 1160777599 19:863085-863107 CCGGCAGGGTGACTCCGGGGGCC 0: 1
1: 1
2: 3
3: 20
4: 183
Right 1160777605 19:863101-863123 GGGGGCCCGCTGGTGTGCGGGGG 0: 1
1: 0
2: 1
3: 28
4: 211
1160777599_1160777609 5 Left 1160777599 19:863085-863107 CCGGCAGGGTGACTCCGGGGGCC 0: 1
1: 1
2: 3
3: 20
4: 183
Right 1160777609 19:863113-863135 GTGTGCGGGGGCGTGCTCGAGGG 0: 1
1: 0
2: 2
3: 2
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160777599 Original CRISPR GGCCCCCGGAGTCACCCTGC CGG (reversed) Exonic
903813233 1:26046279-26046301 GGCCCGCGGAGCCCACCTGCCGG + Intergenic
904035640 1:27557184-27557206 GGACCCGAGGGTCACCCTGCCGG + Intronic
904079609 1:27863701-27863723 GGCCCCCATGGTCACCCTGGTGG + Intergenic
905308149 1:37033128-37033150 GGCCGCCCAAGGCACCCTGCAGG - Intronic
908356617 1:63329463-63329485 GGCCTCCGGGGTCACCCTGGAGG + Intergenic
909667677 1:78153914-78153936 GACCCTTGGAGTCACCCTTCAGG + Intergenic
912070811 1:105806968-105806990 TGCCCCAGGACTCACCCTTCAGG - Intergenic
915879996 1:159659454-159659476 GGCCCCCGAACTCACACTGAAGG - Intergenic
917486089 1:175455855-175455877 CTCCCACGGAGTCACCCTACTGG + Intronic
920295368 1:204952989-204953011 GGCCGTGGGAGTCACCCTGAAGG + Intronic
920340768 1:205273895-205273917 GGCCACCTGAATCTCCCTGCTGG + Intergenic
923031647 1:230253736-230253758 GGTCCCTAGAGTCACCCTACCGG + Intronic
924039510 1:239970864-239970886 GGCTCCCAGAGTCAGCATGCTGG + Intergenic
1063150883 10:3335280-3335302 CGACCCCGGAGTCACACTGGAGG - Intergenic
1063375310 10:5551105-5551127 TGCCCCTGGAGTCACCCTCTGGG + Intergenic
1064704659 10:18059421-18059443 GGCTGCAGGAGTCAGCCTGCCGG - Intergenic
1070753053 10:78975117-78975139 GGACCCCGCAGCCAGCCTGCTGG - Intergenic
1070946292 10:80394718-80394740 GGCCCACTGAGTCACTGTGCTGG - Intergenic
1074130184 10:110567377-110567399 GGCCCTCGGAGTCTCCCTCTTGG + Intergenic
1074454879 10:113588198-113588220 GGCCTCCAGAGTCACCCTAAGGG - Exonic
1075737262 10:124671566-124671588 GGCCCCCGCTGTTTCCCTGCTGG - Intronic
1075782742 10:125027354-125027376 GGACCCAGGAGTCAGCCGGCCGG - Exonic
1076543348 10:131228148-131228170 GGCCTCCGGAGTCTCCCCTCCGG + Intronic
1076934632 10:133559286-133559308 GGCCCCTGAACTCACCTTGCTGG + Exonic
1080606495 11:33869172-33869194 AGCCCCCGGAATCACCCGGGAGG + Intronic
1083638890 11:64134904-64134926 GGCCCTCAGAGTCTCCCTCCAGG + Intronic
1083818338 11:65150741-65150763 GTCAGCCAGAGTCACCCTGCTGG + Intergenic
1088818305 11:113436074-113436096 GGTCCCCGGTGTCAGCCTGCTGG - Intronic
1088834767 11:113568340-113568362 GGGACCCGGATTCTCCCTGCAGG + Intergenic
1089363045 11:117903792-117903814 GCCCCCCGCTGTCTCCCTGCAGG + Exonic
1090537296 11:127657578-127657600 TGCCCCCGGAGTCACAGGGCTGG - Intergenic
1091121199 11:133059084-133059106 GGACCATGGAGTCAGCCTGCTGG - Intronic
1091369071 11:135043834-135043856 TGCTCCCTGAGTCTCCCTGCAGG + Intergenic
1096105935 12:48997198-48997220 GGCCCCCGAAGTAAACCTGCGGG - Exonic
1096404037 12:51329818-51329840 GGCCCCCAGAGTCACCCTGCAGG + Exonic
1097850238 12:64404358-64404380 GGCCTCCGGCGTCAGCCCGCGGG + Exonic
1102235382 12:111291306-111291328 AGCCATCGGAGTCACCCCGCTGG - Intronic
1104049457 12:125186179-125186201 GGCTCCCGGAGCCTCCCGGCCGG + Intergenic
1104516620 12:129432907-129432929 GGCCCCTTGGGTCACCTTGCAGG + Intronic
1104556107 12:129801065-129801087 GGCCCACAGAGTCTCCCTGATGG + Intronic
1105023555 12:132834064-132834086 AACCCCAGGAGTCATCCTGCTGG - Intronic
1106503974 13:30355526-30355548 AGCTCCCGGAGGCCCCCTGCTGG - Intergenic
1106590250 13:31092431-31092453 GCCCACCGGAGTCACACAGCAGG + Intergenic
1110425522 13:75362301-75362323 GTCCCCCGGAGACTGCCTGCCGG - Exonic
1112216436 13:97434816-97434838 GCACCCCGGAGTCACCGTCCCGG + Intronic
1113246512 13:108402748-108402770 GGTCCCCAGTGTCACCCAGCAGG - Intergenic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1113967768 13:114164158-114164180 GGCCCCCTCGGTCCCCCTGCCGG - Intergenic
1114683323 14:24505644-24505666 GGCCCCCAGAGTCTCCCTGTAGG + Exonic
1114690129 14:24573795-24573817 GGCCTCCGGAATCCCCCTGTAGG + Exonic
1120436705 14:84491743-84491765 GGCTCCTGGAGTCAGCCTCCTGG - Intergenic
1121016557 14:90552656-90552678 GTCCCCAGGAGCCACACTGCAGG - Intronic
1123110955 14:105866653-105866675 GGCCCCCTCAGGCACCGTGCGGG + Intergenic
1128918506 15:71589550-71589572 GGCCCCATGTGTCACCCTGTTGG + Intronic
1129155453 15:73714549-73714571 GGCCCCAGGACTCAACCAGCAGG + Intergenic
1129889721 15:79063907-79063929 GGCCCAGGGAGTCTCCCTACAGG + Intronic
1130049069 15:80468233-80468255 GGCCTCAGGAATCTCCCTGCTGG + Intronic
1131195470 15:90351792-90351814 GGCCTCCGCAAACACCCTGCAGG + Intergenic
1131254479 15:90852957-90852979 GGCCCTTCGAGTCACCTTGCTGG - Intergenic
1132008076 15:98249076-98249098 GGGACCCACAGTCACCCTGCTGG - Intergenic
1132370569 15:101295082-101295104 CGCCCCCGGACTCACCCCGGAGG + Exonic
1132660203 16:1057848-1057870 GGACCCCGGTGTCACCCGCCAGG + Intergenic
1132704564 16:1237513-1237535 GCCCTCCCGAGTCACCCTGAGGG + Intergenic
1132706949 16:1248912-1248934 GCCCTCCCGAGTCACCCTGAGGG - Intergenic
1132715169 16:1286497-1286519 GGCCCCCGTTGTCGCCCTGTGGG + Intergenic
1132976313 16:2712799-2712821 GGCCGCCCGAGTCGCCCTGCGGG + Exonic
1132989266 16:2784787-2784809 GTCCCCCAGAATCACCCTGCAGG + Exonic
1132999009 16:2839916-2839938 GCCCCCCGGAGTCACCCTGGGGG + Intergenic
1133325114 16:4937327-4937349 GGCCTCCGGAGTCCCCCGGCTGG - Intronic
1135381013 16:21996251-21996273 GGTGACCCGAGTCACCCTGCAGG + Intronic
1136579709 16:31143822-31143844 GCCCCCCAGAGTCACCCTAGTGG + Exonic
1138599687 16:58047122-58047144 GGCACCTGGGGTCACCCTGCCGG + Intergenic
1140468958 16:75204307-75204329 GGCCTCCAGAGTCACCCTGCAGG + Exonic
1140472813 16:75224698-75224720 GGCCGCCAGAGTCGCCCTGTGGG - Exonic
1140473629 16:75227983-75228005 GGCTGTCGGAGTCACCCTGCAGG - Intergenic
1142132225 16:88436332-88436354 GGCCCCCGGCCTCAGCCTGTGGG + Exonic
1142217059 16:88834927-88834949 GGCCTCCGGGGTCACCCTTCGGG + Intronic
1143107295 17:4536135-4536157 GGCTCCCGGCGTCCCCCAGCAGG - Exonic
1143223728 17:5282621-5282643 GGCCCCGGGGGTGACCCCGCCGG + Intronic
1143548512 17:7614600-7614622 GGCCCCCGGCGTCTCCCCGGAGG + Exonic
1144944489 17:18962830-18962852 TGCCCCCTGTTTCACCCTGCTGG + Intronic
1144968592 17:19093285-19093307 GGTTCCCGGAGTCTCCCAGCTGG + Exonic
1144979323 17:19158778-19158800 GGTTCCCGGAGTCTCCCAGCTGG - Exonic
1144988899 17:19219454-19219476 GGTTCCCGGAGTCTCCCAGCTGG + Exonic
1149772371 17:59331908-59331930 GGCCTCCGGACTCCCCCGGCCGG + Intronic
1151320394 17:73349160-73349182 GGGCCCCGGAGCCAGCCTGGCGG + Intronic
1151605196 17:75131328-75131350 GCCCCCAGGAGCCTCCCTGCGGG - Intronic
1152748332 17:82051403-82051425 GGCCCCCGGAGGCTCCGCGCGGG - Intronic
1153911381 18:9708708-9708730 CGCCCCCGCTCTCACCCTGCCGG + Intronic
1154230682 18:12553350-12553372 GGCCCTGGGACTCACCCTTCAGG - Intronic
1157593702 18:48851195-48851217 GGCCCCAGGAGCCTGCCTGCGGG + Intronic
1160710672 19:549623-549645 GCCCGCCCGAGTCACCCTGCAGG - Exonic
1160774214 19:847743-847765 GGCCACCTGAGTCTCCCTGGAGG - Intronic
1160774229 19:847792-847814 GGCCACCTGAGTCTCCCTGGAGG - Exonic
1160777599 19:863085-863107 GGCCCCCGGAGTCACCCTGCCGG - Exonic
1160896922 19:1407516-1407538 CGCCCCCGGAGACCCCGTGCGGG + Intergenic
1160938740 19:1610182-1610204 GGCCCGAGGGGACACCCTGCTGG + Exonic
1161101991 19:2425920-2425942 GTCCCCCAGCGTCACCCTGTTGG - Exonic
1162118330 19:8445450-8445472 GGCCCCCGAGGTCACCCTCCCGG - Intronic
1163334347 19:16661179-16661201 GGCCCCGGGTGGCACCCGGCAGG + Exonic
1163439371 19:17313939-17313961 GAACCCAGCAGTCACCCTGCAGG + Intronic
1163626316 19:18391924-18391946 GACGCCCTGAGTCACCCAGCAGG + Exonic
1165787970 19:38473676-38473698 CGCCCCCGGGGGCACCCCGCAGG + Exonic
1167621952 19:50565720-50565742 GGCCCCAGCAGGCACCCCGCGGG + Intronic
1167666574 19:50825933-50825955 GTCCCCCAGAGTCACCCTGTGGG + Exonic
1167672257 19:50859965-50859987 GGCCCCCAGAATCACCCTAAGGG - Exonic
1167683948 19:50943771-50943793 GCCCCCCAGAATCACCCTGCAGG + Exonic
1167686379 19:50959301-50959323 GACCCCCAGAATCACCCTGCAGG + Exonic
1167689695 19:50977676-50977698 GTCCCCCTGAGTCACCCTAGAGG + Exonic
1167695751 19:51014937-51014959 GGCCTCCAGAGTCACTCTGGGGG + Exonic
1167705315 19:51078144-51078166 GTCCCCCAGAGTCACCCTGAGGG + Exonic
925918889 2:8625929-8625951 GGCACTCTGAGTCAGCCTGCAGG + Intergenic
926750895 2:16197686-16197708 GGCCCAGCCAGTCACCCTGCTGG + Intergenic
927882128 2:26696301-26696323 GGCTCCCCCAGTCACCCAGCTGG + Intronic
930026844 2:47034269-47034291 TGCCCCCTGAGGCCCCCTGCAGG - Intronic
932413035 2:71558466-71558488 GGCACCATGAGTCACCTTGCAGG - Intronic
933990402 2:87629801-87629823 GGCCTGCTGAGTCACACTGCAGG - Intergenic
934527004 2:95058262-95058284 GGGCCCGGGAGCCACTCTGCTGG - Intergenic
934531256 2:95090566-95090588 AGCCGGAGGAGTCACCCTGCTGG + Intronic
936303444 2:111321023-111321045 GGCCTGCTGAGTCACACTGCAGG + Intergenic
941951486 2:171160821-171160843 GGCCCCCGGCGTCGCCCGGGAGG + Exonic
947749035 2:232523409-232523431 GGCCTCCCGAGTCACCCTGCGGG - Exonic
947907242 2:233774314-233774336 GGCTCCCAGAGTCACCCAGCAGG - Intergenic
948350972 2:237340632-237340654 GGCCCAGAGAGTCATCCTGCAGG - Exonic
948806609 2:240455907-240455929 GGCCCCCTGAGGCCCGCTGCAGG - Intronic
948838904 2:240639874-240639896 GGGCTCCGAAGTCACCCCGCCGG - Intergenic
949035609 2:241814574-241814596 GCCCCCCGGGCCCACCCTGCTGG + Exonic
1168772098 20:421879-421901 GGCTCCTGGAGTCACCCAGGTGG + Intronic
1173566058 20:44039441-44039463 GGCCCCTGCAGTGACCCTTCTGG - Intronic
1173631810 20:44521898-44521920 GGACCCCGAACTCACCCAGCTGG + Exonic
1173820168 20:46014294-46014316 GGCGCCCGGGCTCCCCCTGCCGG - Intronic
1175722522 20:61295831-61295853 GACCCCAGGACACACCCTGCTGG - Intronic
1175967555 20:62667042-62667064 GGCCCCGGGAGTGCACCTGCAGG + Intronic
1180876501 22:19177582-19177604 GGGCCCCGCGGTCACCCCGCCGG + Intronic
1181452603 22:23033957-23033979 GCCCACCGGAGTCACCTGGCAGG - Intergenic
1184391699 22:44206884-44206906 GGGCCCCAGAGTCACCCTCCAGG + Exonic
1184887323 22:47354374-47354396 GGCCCCCAGAGCCTCCCTGATGG + Intergenic
953142738 3:40244638-40244660 GGCTCCCTGTTTCACCCTGCAGG - Intronic
953848786 3:46449550-46449572 GGCCCCCGGATTCATCCAGGAGG + Intronic
953890156 3:46745296-46745318 GGCCTCTGGGGTCTCCCTGCTGG - Intronic
954457195 3:50606228-50606250 GGCCAGGGCAGTCACCCTGCAGG + Intergenic
954797309 3:53168172-53168194 GACCCCTGGAGTCAGCCTGTGGG + Intronic
955032434 3:55233921-55233943 AGTCCCCGGAGACACCCTGAGGG - Intergenic
961478131 3:127161313-127161335 GGCCACCGTAGTCTCCCCGCTGG + Intergenic
961514867 3:127426253-127426275 TGCTCCTGGAGCCACCCTGCTGG - Intergenic
967968915 3:194985077-194985099 GGCCCCAGAGGTCTCCCTGCAGG - Intergenic
969330439 4:6471296-6471318 GGCCCGCGGAGTGACCCCGATGG - Intronic
970694405 4:18660052-18660074 GCCCCCAAAAGTCACCCTGCAGG - Intergenic
973254350 4:48094039-48094061 GGCTCCCTGACTCACCCAGCTGG + Intronic
974831291 4:67192827-67192849 GACCCCAAGAGTCACACTGCCGG + Intergenic
975666590 4:76740225-76740247 TGCCCCCGGGGTAACCCTCCTGG - Exonic
978318530 4:107466986-107467008 GGCCCCCACAGTCACCTTGAGGG + Intergenic
982629941 4:157819493-157819515 GGCCACAGGGGACACCCTGCTGG - Intergenic
983533132 4:168832036-168832058 AGCCTCCTGAGTCACCCGGCGGG + Intronic
985679034 5:1246428-1246450 GGCCCCCTGAGCCACCCGGGCGG - Intergenic
985797209 5:1972141-1972163 GGCCCCCGGAGCCCCCGAGCAGG - Intergenic
986689864 5:10305454-10305476 GGCCACAGGAGTCACTCTGTAGG + Intronic
987237443 5:15957295-15957317 GACCCCAGCAGCCACCCTGCAGG + Intergenic
997265214 5:132491106-132491128 GGCCCCAGGAGCCAGCCGGCTGG - Intergenic
997665953 5:135629615-135629637 CGCCCACAGAGTCAGCCTGCTGG - Intergenic
1002188441 5:177466859-177466881 GGCCCCCGGGCGCACCCTGACGG - Intronic
1002771105 6:291897-291919 GGCCCCCGGAGTCGCCCCAGGGG + Intronic
1004263685 6:14130643-14130665 GGCCTCCTGAGTCAACCTTCTGG - Intronic
1005882381 6:30071308-30071330 GGCACCCGAACCCACCCTGCTGG - Exonic
1005989989 6:30896724-30896746 TGCCCCCGGTGACGCCCTGCAGG - Exonic
1015785770 6:136921276-136921298 GCCACGCGGAGTCTCCCTGCAGG + Intergenic
1018694646 6:166382440-166382462 GGCGCCCACTGTCACCCTGCCGG + Intronic
1019354511 7:571699-571721 GGCCCCTGGAGTTCCCCTCCCGG - Intronic
1019413310 7:916035-916057 GGCCCCTGGAGTGGCCCTTCTGG - Intronic
1019556840 7:1636117-1636139 GGCCCAGGAAGTCACCCTGGAGG + Intergenic
1021600090 7:22356567-22356589 GGCCCCCAGATTCAGGCTGCGGG - Intronic
1021717022 7:23469854-23469876 GGCCCGCGGAGCCACCCGGTGGG + Intronic
1023670878 7:42575337-42575359 GGCCCTCGGGGCCACTCTGCCGG - Intergenic
1026982581 7:74535556-74535578 GGGCTCTGGAGTCACACTGCTGG - Intronic
1029260185 7:99296910-99296932 TGCCCTCAGACTCACCCTGCAGG - Intergenic
1030106075 7:105988451-105988473 GGGTCCACGAGTCACCCTGCTGG + Intronic
1032538490 7:132684316-132684338 GGCCCCCTCAGACACCCTGGAGG - Intronic
1033582915 7:142752861-142752883 GGCCACCAGAATCACCCTGGGGG - Exonic
1033585941 7:142774349-142774371 GGCCACCAGAATCACCCTGGGGG - Intergenic
1033605862 7:142928243-142928265 GGCCCCCTGACTCATCCTGGTGG - Intronic
1034536515 7:151729008-151729030 GACTCCCGGAGTCACTCAGCAGG - Intronic
1035105948 7:156441679-156441701 GGCACCCGGAGTCACACAGTGGG + Intergenic
1036643250 8:10597140-10597162 GGCACCCTGGGTCACCATGCTGG + Intergenic
1037816832 8:22116898-22116920 GGCCCCCGGAGAGGCCGTGCTGG - Exonic
1038032005 8:23650834-23650856 TGCCCACGGAGTCTCCCTGATGG - Intergenic
1038701429 8:29852997-29853019 AGCCCCCGGAGACAGACTGCTGG - Intergenic
1047714981 8:127587176-127587198 GGCCCCTGAAGTCACACTGAAGG - Intergenic
1048204393 8:132403766-132403788 GGCACCCAGGCTCACCCTGCTGG + Intronic
1048635345 8:136289450-136289472 GGCCCCCAGAGTTAGCCTGTCGG + Intergenic
1049753175 8:144295383-144295405 AGCCCCAGGAGCCACCCAGCTGG + Intronic
1051352972 9:16215609-16215631 GGCCCCAGGAGACAACTTGCTGG + Intronic
1056793140 9:89639185-89639207 GGCCCCAGGAGCCACACTGCGGG - Intergenic
1057293071 9:93819345-93819367 AGCCCCCGGCGTCACCCTCAGGG - Intergenic
1059432750 9:114259960-114259982 GGGCACCGGAGGGACCCTGCTGG - Intronic
1060821027 9:126661685-126661707 GGGCCCCGCAGCCACACTGCAGG - Intronic
1061584717 9:131558307-131558329 GGCCCCCAGATTCCCTCTGCAGG - Intergenic
1061808085 9:133147613-133147635 GTCCCCCAGAGGGACCCTGCCGG + Intronic
1203774827 EBV:67022-67044 GGCGGCCGCCGTCACCCTGCCGG + Intergenic
1187251037 X:17598101-17598123 AGCCCCCTGAGTCTACCTGCTGG - Intronic
1189532621 X:41902020-41902042 GGCCTCCAGACTCACCCTGGCGG - Intronic
1190279771 X:48922086-48922108 GGCCCCCAGACAGACCCTGCTGG + Intronic
1190464012 X:50707929-50707951 GGGCCCTGGACCCACCCTGCAGG + Intronic
1192081674 X:68053719-68053741 GGCCCCCAGATCCTCCCTGCCGG - Exonic
1193148882 X:78104593-78104615 AGCACCCGAAGTCACCCTTCGGG + Intronic
1197749448 X:129954616-129954638 GGCGCCCAAAGTCACCCTGCTGG + Intergenic
1200383555 X:155865518-155865540 GGCTGCCGGAGTGTCCCTGCTGG + Intergenic
1202183900 Y:22164247-22164269 GGCCCCAGGAGTAACACTTCGGG - Intergenic
1202207459 Y:22422154-22422176 GGCCCCAGGAGTAACACTTCGGG + Intergenic