ID: 1160777625

View in Genome Browser
Species Human (GRCh38)
Location 19:863211-863233
Sequence GGCCTGGATCGACAGCGTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 71}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160777622_1160777625 -4 Left 1160777622 19:863192-863214 CCCGCGTGGCGAGCTATGCGGCC 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1160777625 19:863211-863233 GGCCTGGATCGACAGCGTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 71
1160777620_1160777625 8 Left 1160777620 19:863180-863202 CCGGGATCTACACCCGCGTGGCG 0: 1
1: 0
2: 1
3: 1
4: 18
Right 1160777625 19:863211-863233 GGCCTGGATCGACAGCGTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 71
1160777623_1160777625 -5 Left 1160777623 19:863193-863215 CCGCGTGGCGAGCTATGCGGCCT 0: 1
1: 0
2: 1
3: 5
4: 42
Right 1160777625 19:863211-863233 GGCCTGGATCGACAGCGTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 71
1160777619_1160777625 9 Left 1160777619 19:863179-863201 CCCGGGATCTACACCCGCGTGGC 0: 1
1: 2
2: 0
3: 3
4: 35
Right 1160777625 19:863211-863233 GGCCTGGATCGACAGCGTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 71
1160777617_1160777625 19 Left 1160777617 19:863169-863191 CCGCAAGAAGCCCGGGATCTACA 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1160777625 19:863211-863233 GGCCTGGATCGACAGCGTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160777625 Original CRISPR GGCCTGGATCGACAGCGTCC TGG Exonic
900674545 1:3876798-3876820 GGCCTGCACAGAGAGCGTCCAGG + Intronic
901129494 1:6953449-6953471 GGCCTGAAGCCACAGCCTCCGGG - Intronic
902199865 1:14825288-14825310 GGCCTGGAGAGACAGCTTCCAGG - Intronic
906495510 1:46302122-46302144 GGCCTGGATGGAGGGCGGCCTGG - Intronic
911041508 1:93594536-93594558 GCCCTGGACCGCCAGCCTCCAGG + Intronic
915786102 1:158613722-158613744 TCCCTGGATCCACAGCATCCAGG + Exonic
916792407 1:168136352-168136374 GGCCCGCATCGGCAGAGTCCCGG + Intronic
917865813 1:179193945-179193967 GGCCAGGATCGAGACCATCCTGG - Intronic
1065797199 10:29318652-29318674 GGCCCGGCTCGACAGCGACCCGG - Intergenic
1065945955 10:30605681-30605703 GGCCTGGCCCGACAGTGACCAGG + Intergenic
1073476536 10:103757332-103757354 GGCCTGGGTCTCCAGAGTCCTGG - Intronic
1088817643 11:113432722-113432744 GGCCTATATCGCCAGGGTCCTGG - Intronic
1089257059 11:117199599-117199621 GGGCTGGATCACTAGCGTCCTGG + Intronic
1091742405 12:2969160-2969182 ACCCTGGATCGACAGTGTTCAGG + Intronic
1092946059 12:13455257-13455279 GTCCTGGATTGACAGCTCCCAGG - Intergenic
1096499742 12:52057430-52057452 GGACTGGATTGACAGTATCCTGG + Exonic
1119679788 14:76583996-76584018 GGCCTGGAACGAGAGTGTCCAGG - Intergenic
1122930954 14:104932917-104932939 GGCCTGGACGGACAGGCTCCGGG + Exonic
1122967257 14:105137188-105137210 TGCCTGGACCCACAGCGTGCAGG - Intergenic
1123075847 14:105667095-105667117 GCCCAGGATGGACAGCTTCCGGG - Intergenic
1131054524 15:89367747-89367769 GGCCTGCCTCGACGGCGTCCCGG - Intergenic
1133255738 16:4514628-4514650 GGCCTGGATGGACAGGGAACAGG + Exonic
1134747464 16:16599342-16599364 AGCCTGGATCCCCAGCTTCCTGG - Intergenic
1141663253 16:85453015-85453037 GCCCTGGACCGGCAGCGTCGGGG - Intergenic
1142698170 17:1644863-1644885 GGCTTGCATCGACAGAGGCCCGG + Exonic
1142752648 17:1998052-1998074 GGCCGGGATCGATCGCGGCCTGG - Intronic
1148158657 17:45437563-45437585 GCCCTGGCTCACCAGCGTCCCGG - Exonic
1148854792 17:50572833-50572855 TGCCTGGATCGCCATCTTCCAGG + Exonic
1149991788 17:61387595-61387617 GGCCAGGATGGACAGCCCCCAGG - Intronic
1150390078 17:64784962-64784984 GCCCTGGCTCACCAGCGTCCCGG - Intergenic
1150904811 17:69326683-69326705 AGGGTGGAACGACAGCGTCCAGG + Intronic
1152920478 17:83064174-83064196 GGCCTGGATGGACGGCAGCCAGG - Intergenic
1159954648 18:74510635-74510657 GGCCTGGAGCCACAGCGGCCTGG + Intronic
1160383747 18:78480811-78480833 GTCCGGGGCCGACAGCGTCCAGG - Intergenic
1160436073 18:78853796-78853818 GGCCTGGCTCAACAGCCCCCAGG - Intergenic
1160777625 19:863211-863233 GGCCTGGATCGACAGCGTCCTGG + Exonic
1161311324 19:3595718-3595740 GGGCTGGAGGGACAGCGACCTGG + Exonic
1161623059 19:5309354-5309376 GGCCTGCATAGACAGGGCCCTGG - Intronic
1165738423 19:38192125-38192147 TGCCTGGAATGACAGCGTCAGGG - Exonic
1166747532 19:45148493-45148515 GGGCTGGATCCACAGTGGCCAGG - Intronic
930163420 2:48180648-48180670 GGGCTGGATCCACTGCTTCCTGG - Intergenic
932356000 2:71068787-71068809 GGCCTTGATCCTCGGCGTCCGGG + Intronic
938087346 2:128410141-128410163 GGCCTGGAAGGACAGATTCCAGG + Intergenic
945279793 2:208025492-208025514 GGCCGGGATGGTCAGCGCCCGGG - Exonic
948461373 2:238131453-238131475 GGCCTGGACCGACGGCTTCGAGG + Exonic
1168904604 20:1393039-1393061 GGCGTGGACCAACAGCGACCTGG + Exonic
1171035859 20:21712785-21712807 GGCCGGGGTTGCCAGCGTCCGGG - Intronic
1172742332 20:37179032-37179054 GGCCTGGCCCAACCGCGTCCCGG + Exonic
1175310989 20:58011488-58011510 GGCCTGCTCCCACAGCGTCCTGG + Intergenic
1180185490 21:46137176-46137198 GGCCTGGATTCACAGCCTCAGGG - Intronic
1183418596 22:37697180-37697202 TGCCTGGATGGAGAGGGTCCCGG + Intronic
953886193 3:46715611-46715633 GCCCTGGATGGTCAGCGTGCGGG - Exonic
960874926 3:122286732-122286754 GGCCTGGACCTCCAGCATCCAGG + Intergenic
968642285 4:1720848-1720870 GGCCTAGCTCGACAGCTTCCCGG - Exonic
978881218 4:113705104-113705126 GGCCAGGATCGAGACCATCCTGG + Intronic
984710524 4:182880473-182880495 GGCTTGCATTGACAGAGTCCAGG + Intergenic
985688437 5:1294261-1294283 GGCCTGGAACCATAGCGTCAGGG - Exonic
995063880 5:107839282-107839304 GGCCTTGAAAGACAGCGTCGAGG - Intergenic
1002296054 5:178232092-178232114 GGCCTGGCTCGAGAGTGACCTGG - Intronic
1006940909 6:37751780-37751802 GGCCTGGAAGGACAGCGTGATGG - Intergenic
1009396972 6:63211494-63211516 GGCGTGGACCGACAGCGACCTGG - Exonic
1010444003 6:75931011-75931033 GGCCTGGTTCCAGACCGTCCAGG + Exonic
1013155076 6:107485720-107485742 GGTCGGGATCGACACCATCCTGG + Intergenic
1029201423 7:98841841-98841863 GGCATGGATGGGCAGGGTCCTGG - Intergenic
1029420475 7:100469431-100469453 GGCCTGGCTCAACAGCCCCCAGG + Intronic
1034258779 7:149740858-149740880 GGCCAGGATCGAGAGCAGCCTGG + Intergenic
1048341155 8:133539411-133539433 GGGCTGGAGCGTCAGCTTCCTGG - Intronic
1049986796 9:959345-959367 GGCCTGGGCTGACAGGGTCCTGG + Intronic
1051505072 9:17817954-17817976 GGCCTGGGTAAACAGAGTCCAGG - Intergenic
1057138092 9:92709163-92709185 GGCCTGCATTGACAGAGTCAGGG + Intergenic
1057893134 9:98884641-98884663 AGTCTGGACCGGCAGCGTCCAGG + Intergenic
1058103182 9:100938626-100938648 GTCCTGGATAGGCAGCTTCCTGG + Intergenic
1058876825 9:109251909-109251931 GGCCTGCATGGACAGAGCCCTGG + Intronic
1060964816 9:127706614-127706636 GGCCTGGGGTGACAGTGTCCTGG - Intronic
1061933809 9:133846571-133846593 GCCCTGGATAGAGAGCGGCCGGG - Intronic
1191257046 X:58284045-58284067 GGCCTGGAACGAAAGCAGCCAGG - Intergenic
1191797482 X:65035671-65035693 GGCATGGAGCGACAGCAGCCCGG - Intergenic
1192873058 X:75203652-75203674 GGCCTGGATGGGCAGGGTCTGGG + Intergenic
1197112466 X:122792904-122792926 GGCCTGGAACCAAAGCCTCCTGG + Intergenic