ID: 1160779139

View in Genome Browser
Species Human (GRCh38)
Location 19:870126-870148
Sequence GGGCCCTGGGCCATATGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 185}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160779130_1160779139 13 Left 1160779130 19:870090-870112 CCCGGGAGATCCTCCTGATGAGG 0: 1
1: 0
2: 0
3: 9
4: 140
Right 1160779139 19:870126-870148 GGGCCCTGGGCCATATGCTAAGG 0: 1
1: 0
2: 0
3: 8
4: 185
1160779132_1160779139 12 Left 1160779132 19:870091-870113 CCGGGAGATCCTCCTGATGAGGT 0: 1
1: 0
2: 1
3: 13
4: 120
Right 1160779139 19:870126-870148 GGGCCCTGGGCCATATGCTAAGG 0: 1
1: 0
2: 0
3: 8
4: 185
1160779133_1160779139 3 Left 1160779133 19:870100-870122 CCTCCTGATGAGGTGTCTGCTCA 0: 1
1: 0
2: 1
3: 14
4: 138
Right 1160779139 19:870126-870148 GGGCCCTGGGCCATATGCTAAGG 0: 1
1: 0
2: 0
3: 8
4: 185
1160779134_1160779139 0 Left 1160779134 19:870103-870125 CCTGATGAGGTGTCTGCTCAGCA 0: 1
1: 0
2: 1
3: 8
4: 161
Right 1160779139 19:870126-870148 GGGCCCTGGGCCATATGCTAAGG 0: 1
1: 0
2: 0
3: 8
4: 185
1160779127_1160779139 22 Left 1160779127 19:870081-870103 CCTCTTGCCCCCGGGAGATCCTC 0: 1
1: 0
2: 0
3: 11
4: 141
Right 1160779139 19:870126-870148 GGGCCCTGGGCCATATGCTAAGG 0: 1
1: 0
2: 0
3: 8
4: 185
1160779128_1160779139 15 Left 1160779128 19:870088-870110 CCCCCGGGAGATCCTCCTGATGA 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1160779139 19:870126-870148 GGGCCCTGGGCCATATGCTAAGG 0: 1
1: 0
2: 0
3: 8
4: 185
1160779129_1160779139 14 Left 1160779129 19:870089-870111 CCCCGGGAGATCCTCCTGATGAG 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1160779139 19:870126-870148 GGGCCCTGGGCCATATGCTAAGG 0: 1
1: 0
2: 0
3: 8
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160779139 Original CRISPR GGGCCCTGGGCCATATGCTA AGG Intronic
900522813 1:3113761-3113783 GGGCCCTGGGCCAGAGGCAGAGG + Intronic
902544966 1:17184428-17184450 GAGCTCTGGGCCAGATGCCATGG + Intergenic
903184218 1:21620259-21620281 TGGCCCTGGGCCCTAGGCTCTGG - Intronic
903652930 1:24932235-24932257 GGGCCCTGCGCCAGGTGCCAGGG - Intronic
904273409 1:29365009-29365031 GGGCCCTGAGCACTAGGCTAAGG - Intergenic
904489063 1:30847097-30847119 GAGAACTGGGCCAGATGCTATGG + Intergenic
904789001 1:33003884-33003906 GGGCCCTGGGCTGCATGATAGGG + Intergenic
905240396 1:36577228-36577250 GGGCCCTGAGCCACCTGCCATGG + Intergenic
905243122 1:36594215-36594237 GGGCCCTGGGCTGGTTGCTAAGG + Intergenic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
905911694 1:41659471-41659493 GGGCCCTGGGCACCATTCTAGGG - Intronic
907417001 1:54321415-54321437 GAGCCCTGGGACAGAAGCTAGGG - Intronic
907531933 1:55107980-55108002 GGTCACTGTGCCATATGCTGAGG + Intronic
907877437 1:58505277-58505299 TGGTACTGGGCCATGTGCTAAGG - Intronic
909057139 1:70834344-70834366 GGGGCCAGGGCCAAATGATATGG + Intergenic
910624725 1:89294009-89294031 GGGCTCTGGGTCACATTCTATGG + Intergenic
911957098 1:104251077-104251099 GGGCCATGGGCCATGGGCCATGG + Intergenic
912802182 1:112726963-112726985 GGCTTCTGGGCCACATGCTATGG + Exonic
913123621 1:115765229-115765251 GGGCCCTGGGATAGATGCTGTGG - Intronic
916786227 1:168089141-168089163 GGACCCTGTGCCAGATGCTGGGG - Intronic
919973022 1:202592995-202593017 TGGCCCTGAGCCCCATGCTATGG - Exonic
923471223 1:234292649-234292671 GGGCCCTGGGGCTCATACTAGGG + Intronic
1062911178 10:1213442-1213464 GGGGCCTGGGCCAGTGGCTAGGG + Intronic
1063095681 10:2906681-2906703 GGGAACTGGGGCATGTGCTAAGG - Intergenic
1067683768 10:48455577-48455599 GGGCCCTGGGACATGGGCCAGGG + Intronic
1073252990 10:102133358-102133380 GGGCCCTAGGCCGTTTGCTGGGG + Intronic
1075823821 10:125336630-125336652 GGTCCCTTGGTCAAATGCTATGG - Intergenic
1076437580 10:130456701-130456723 TGGCCCTTGGCCATCTGTTATGG - Intergenic
1078000168 11:7487561-7487583 TGGCCCTGTGCCAAGTGCTAGGG + Intronic
1078600650 11:12727395-12727417 GGGCCCTGGGGCATAGTCTGTGG + Intronic
1078668450 11:13344855-13344877 GGGCCAGGGGCCATCTGCCATGG + Intronic
1078989980 11:16636608-16636630 GGGCCCGGGGCAAAATGATATGG + Intronic
1080451936 11:32385010-32385032 GGGCCCTGGGCCATCTTCGCTGG + Intergenic
1083310009 11:61779233-61779255 GGGCCATGGGCCATGGGCCATGG - Intronic
1084849842 11:71929752-71929774 GGGTTCTGGGCCAGGTGCTAGGG + Intronic
1088504526 11:110515187-110515209 GGTCCCTGGGCCATTTGTTCTGG + Intergenic
1088815443 11:113417587-113417609 GGACCCTTGGCCATGTGCCAAGG + Intronic
1090212921 11:124935637-124935659 GGGCACTGGGCCATTTCGTATGG - Intronic
1090866238 11:130703395-130703417 GGGCCCTGAGGCATGTGCTGGGG - Intronic
1091028263 11:132160915-132160937 AGGCCCTGGGCCATCTGCCGTGG - Intronic
1091660011 12:2376444-2376466 GGGCTCTGTGCCACATGCTGGGG - Intronic
1093768148 12:22988579-22988601 GGGTGCTGGGCCCCATGCTAAGG - Intergenic
1099780156 12:87183603-87183625 GGGCCCTGGCCCATTTGTTTTGG + Intergenic
1104600874 12:130152521-130152543 GGGGCCTGCGGCCTATGCTAAGG - Intergenic
1108005730 13:45944464-45944486 AGACCCTGGGGCACATGCTAGGG + Intergenic
1108828905 13:54452631-54452653 GGGCACTAGCCCTTATGCTAGGG - Intergenic
1109274686 13:60290646-60290668 GAGCCCTGGGCCATAGGCTGGGG - Intergenic
1109530484 13:63637671-63637693 AGGGCCTGGGAAATATGCTAAGG - Intergenic
1109776538 13:67048383-67048405 AAGCCCTGGCCCATATGCTCAGG + Intronic
1110083273 13:71345021-71345043 GGGCCATGGGCAAAATGATATGG - Intergenic
1111343223 13:86914721-86914743 GGGCCCTGGGCAGAATGGTATGG + Intergenic
1113800168 13:113082377-113082399 GGGTCCTGGGCCTGATGCTGTGG - Intronic
1117316298 14:54574122-54574144 GGGCCCTGGGCTCTCTGCTGGGG - Intronic
1121251777 14:92505162-92505184 GGGCCCTGTGCTATGTCCTATGG - Intergenic
1122255546 14:100473162-100473184 GGGCCCTGGGCTATGTGCCCTGG + Intronic
1122416932 14:101554520-101554542 GTGCCCTGGGCACTATTCTAGGG + Intergenic
1122596643 14:102898409-102898431 GGGCCCTCAGCAAAATGCTAGGG - Intronic
1122751068 14:103933693-103933715 GGGACCTGGGCCAGATGCGGTGG - Intronic
1125675911 15:41502559-41502581 GGGCACTGGGCCAGATGACAGGG - Intronic
1127908564 15:63396164-63396186 GGGAGCTGGGGCATTTGCTAGGG - Intergenic
1128766752 15:70255773-70255795 GGGCCTGGGGCCAAATGCTCTGG - Intergenic
1129225584 15:74168606-74168628 GGGCCAAGGGCCATTTGTTAGGG - Intergenic
1129622210 15:77158287-77158309 GAGCCCTGTGCCAAGTGCTAAGG - Intronic
1131050837 15:89346833-89346855 GGGCCCTTGGCCCTATGCGCTGG - Intergenic
1133686469 16:8169978-8170000 GGGCACTGTGCTATGTGCTAGGG + Intergenic
1135028146 16:19014534-19014556 GTGCCGTGTGCCATATGCCATGG + Intronic
1135048592 16:19173982-19174004 AGGCCCTGGGCTAAGTGCTAGGG - Intronic
1137548751 16:49422245-49422267 GTGCCCTGGGTCACATGCTAAGG + Intergenic
1138490197 16:57372202-57372224 GGGCCCCAGGCCAGATCCTAGGG + Intergenic
1139404425 16:66706798-66706820 AGGCACTGGGCCATATCCTGGGG + Intergenic
1139678333 16:68540209-68540231 GGGCCCTGGGTCAGAAGCTGGGG - Intronic
1140308137 16:73822986-73823008 ATGCACTGGGCTATATGCTAAGG + Intergenic
1141706697 16:85669143-85669165 GGGGCCTGTGCAATATCCTAGGG - Intronic
1142567080 17:847338-847360 GAGCCCTGGGCCAAATGACAAGG + Intronic
1143949909 17:10624214-10624236 TGGCCCTGGGCTTTTTGCTAAGG + Intergenic
1144937546 17:18912432-18912454 GGGGCCGGGGCAAAATGCTATGG - Intronic
1147882851 17:43665264-43665286 GGTCCCTGGGCCAGATGCAGAGG - Intergenic
1148029330 17:44608763-44608785 GGGCCCTGGCACCTAGGCTAAGG - Intergenic
1149494857 17:57110940-57110962 GGGCCCTGGGCTCTGTGCTCAGG + Intronic
1152365208 17:79851624-79851646 GGGCACTGTGCCAGATGCCAGGG - Intergenic
1154491646 18:14926496-14926518 GGGCCCTGGGTCCTCTGCTGTGG + Intergenic
1158893409 18:61893642-61893664 GGGCCCTGGGGCAACTTCTAGGG + Exonic
1160779139 19:870126-870148 GGGCCCTGGGCCATATGCTAAGG + Intronic
1161473768 19:4473587-4473609 GGGCCGAGGGCCATGTGCTAGGG + Intronic
1161698678 19:5783775-5783797 GGGCCCCGGGCCAGAGGCTCTGG - Exonic
1162065435 19:8122652-8122674 GGGCGCTGGGCCAGGTGCGATGG - Intronic
1162556174 19:11387195-11387217 AGGCCCTGTTCTATATGCTAGGG - Intronic
1163266794 19:16226820-16226842 GGGCACTGGGGCCTAGGCTAAGG + Intronic
1164787190 19:30942896-30942918 GGGCCCTGGGCCATCTCAAAGGG + Intergenic
926144125 2:10386514-10386536 GGGCCCTGGGCCACTTGGGAGGG - Intronic
926681131 2:15665094-15665116 GGACCCCGGGCCACATGCGAGGG + Intergenic
926698972 2:15790112-15790134 TGGCCCTGGGCCACGTGATAAGG - Intergenic
932571323 2:72940001-72940023 GGGGCCTGGGCCATGTGGTGGGG - Intergenic
934728027 2:96637855-96637877 GGGTCCTGGGCGGTTTGCTAGGG - Intronic
935731637 2:106069028-106069050 GGCCACTGGGCCATAGGTTAGGG - Intronic
937229524 2:120389428-120389450 GGGCCCGGGGCCAGAGGCCAGGG - Intergenic
940596433 2:155799286-155799308 GGGCCCAGGACCATAGTCTAAGG + Intergenic
942768457 2:179485847-179485869 GTGACCTGGGTTATATGCTAGGG - Intronic
944834950 2:203570108-203570130 GGGCACTGTGCCAAATGCTGGGG + Intergenic
948122584 2:235542283-235542305 TGGCCCTGGCCCTTATGCTCAGG - Intronic
949002592 2:241624936-241624958 GAGCTCTGGGCCATATTCTGGGG + Intronic
1170834538 20:19872397-19872419 GGGCACTGGTCCAAATGCAAAGG + Intergenic
1171197483 20:23211510-23211532 GGAGCGTGGGCCATATGCTCAGG - Intergenic
1171515026 20:25723401-25723423 GGGCCCTGTGCTAGTTGCTAAGG + Intergenic
1173158325 20:40633645-40633667 GGGCCTTGGGCCATGTGTTGGGG - Intergenic
1173841073 20:46157687-46157709 GGGGCCTGGGGCATATGCCCAGG + Intergenic
1175919096 20:62441719-62441741 GGGGCCTGGGCTATATGCTGTGG - Intergenic
1176379984 21:6107538-6107560 TGTCCCTGAGCCATATGCTGAGG - Intergenic
1176860557 21:14009529-14009551 GTGCCCTGAGCCATGTGCAAGGG + Intergenic
1179743490 21:43430700-43430722 TGTCCCTGAGCCATATGCTGAGG + Intergenic
1181530697 22:23515622-23515644 GGGCCCTGAGCCAAGTGCTGGGG - Intergenic
1181803901 22:25363795-25363817 AGGCCCTGGACCAGCTGCTAGGG + Intronic
1182119961 22:27780023-27780045 AGCCCCTGGGCCATAGGTTAGGG - Intronic
1183381677 22:37493346-37493368 GGGCCGTGGGGCACATGCCAGGG - Intronic
1183402293 22:37611620-37611642 CTGCCCTGGGCCATATGTTATGG - Intronic
1183432617 22:37774816-37774838 GGGCCCTGGGCCCTACTCCAGGG - Exonic
1184692135 22:46122260-46122282 GGGCCCTGGGACCCATGCTGGGG + Intergenic
951737680 3:25885759-25885781 GGGCCCTGGGCCATGAGCACAGG + Intergenic
953823533 3:46230660-46230682 GGGGGCTGGGCCCTCTGCTAAGG - Intronic
954791376 3:53135878-53135900 TGGCCCTGGGCCCAACGCTAAGG - Intergenic
956324677 3:68038506-68038528 GGGCTCTGTGCCATGTACTATGG - Intronic
957621055 3:82594194-82594216 GGGCCAGGGGCGAAATGCTATGG - Intergenic
962199590 3:133390424-133390446 GGTCCATGGGCCATACGTTAAGG - Intronic
962315967 3:134359721-134359743 GGGCCCAGGGCCTTATGCACTGG - Intronic
965521456 3:169671470-169671492 AGGACCTGGGCCACATGCTGAGG + Intergenic
965543983 3:169896914-169896936 GGGACCTGGGGCATATGGGAAGG + Intergenic
965638954 3:170812907-170812929 GGGCCCTGTGCCACATGCTGGGG - Intronic
969296042 4:6270996-6271018 AAGCCCTGGGCCAAATGCCAGGG - Intronic
969580203 4:8060371-8060393 GGGGCCTGGGCCATTTCCCATGG + Intronic
969637772 4:8379287-8379309 GGGCCCTGGGCTGAATGCTAAGG - Intronic
969707201 4:8818527-8818549 GGGCCCTGGCCCAGGTGCTTGGG + Intergenic
975038044 4:69709465-69709487 GGGCCAGGGGCCAAATGATATGG - Intergenic
981180130 4:141731988-141732010 AGGCCCTGTGCTAAATGCTAGGG + Intronic
982037408 4:151359774-151359796 GGGCACTGTGCCAGTTGCTAAGG + Intergenic
982118003 4:152113700-152113722 GGGCCCCGGGAGATAAGCTAAGG + Intergenic
985962478 5:3312966-3312988 GGGCCCTGGGCCACAGGCACAGG - Intergenic
999140373 5:149357758-149357780 GGGCCCTGGTCCTGATGCTGAGG + Intergenic
1001158053 5:169290189-169290211 GTGCACTAGGACATATGCTAGGG + Intronic
1001221103 5:169901809-169901831 GGACCCTCAGCCATGTGCTATGG + Intronic
1001457473 5:171875802-171875824 GGACTCTGGGCCGGATGCTAGGG - Intronic
1002599387 5:180345683-180345705 AGGCCCTGGGCCAGGTGCTGGGG - Intronic
1004755482 6:18606063-18606085 GTGCCCTGTGCCATAAGATATGG - Intergenic
1004789482 6:19008266-19008288 AGTCCCTGGGACATATGCTGAGG + Intergenic
1007105819 6:39282249-39282271 GGCCCCTGGGCCACCTGCTCTGG - Intergenic
1007638174 6:43313496-43313518 GGGCCCTGTGCTAGATGCTGGGG - Intronic
1010262307 6:73830942-73830964 GGGGGCTGGACCATATGCCATGG + Intergenic
1019300011 7:298118-298140 GGCCCCTTGGCAAGATGCTAGGG + Intergenic
1020136541 7:5591339-5591361 CTGCCCTGAGCCATATACTATGG - Intergenic
1022865833 7:34418897-34418919 GGGCCCTGGGTTAAATGCCAGGG - Intergenic
1024283486 7:47737964-47737986 GGGTCCTGAGCCACAGGCTAAGG + Intronic
1024802297 7:53094324-53094346 GGCCCCTTGACCATATGCTCGGG - Intergenic
1031150937 7:118053527-118053549 GGGCACTGAGCCAGATGCTGAGG + Intergenic
1032138945 7:129308802-129308824 GTGCCCTGGGCCACATGATCTGG + Intronic
1032801423 7:135320205-135320227 GGGCCATGGGCCATCTCCTCCGG - Intergenic
1033209109 7:139447308-139447330 CCGACCTGGGCCATATGGTATGG + Intergenic
1033584833 7:142766532-142766554 GGGGCCTGGGCCAGAAGCTGTGG - Intergenic
1034285358 7:149880219-149880241 TGGCCCTGGGCTCTGTGCTAGGG + Exonic
1034430543 7:151039102-151039124 GGGCCGTGGGCTGTAGGCTACGG - Intronic
1037987702 8:23299960-23299982 GGGCCCTGTGCCTTTAGCTAAGG + Intronic
1038711441 8:29950650-29950672 GGGCCCTGGGCTGTTTGCTTGGG - Intergenic
1039495166 8:37974921-37974943 GGGCCCTCAGCCATGTGCCAGGG - Intergenic
1040319464 8:46285386-46285408 GTGCCCTGGGCCAAAGGCTGGGG + Intergenic
1041569961 8:59326554-59326576 GGGTCCTGGGCCACATCCTTAGG + Intergenic
1042982012 8:74540375-74540397 GGGCCATGGGCAAAATGATATGG - Intergenic
1043660726 8:82736860-82736882 TGGCCATGGGCCAAATGATATGG + Intergenic
1045516374 8:102863903-102863925 GCGGCCTGGGCCATAGGCTGCGG + Exonic
1048344364 8:133565820-133565842 TGGCCCTGGCCCATCTGCTCCGG - Intronic
1048820527 8:138376228-138376250 GGGCCCTGGGCCAGGTGCAATGG - Intronic
1050132213 9:2424644-2424666 GGGCTGTTGGCCTTATGCTAGGG - Intergenic
1051510942 9:17877321-17877343 AGGCCCTGGGCTAGATGCTGAGG - Intergenic
1055468615 9:76590126-76590148 GGCCCCTTGTCCATCTGCTAAGG + Intergenic
1059206727 9:112474354-112474376 GGGTCCTGCTCCATATGCTGGGG + Intronic
1060155590 9:121317903-121317925 GGGCCCTGGGCCAGCTGATCTGG + Intronic
1060932193 9:127496198-127496220 TGGCCCTGGGCCATTAGGTAAGG - Intronic
1060973347 9:127751503-127751525 AGGCCCTGTGCTATATGCCAGGG + Intronic
1061219400 9:129241664-129241686 GGGCGGGGGGACATATGCTAGGG - Intergenic
1062037377 9:134388808-134388830 GTGCCCTGGGGCAGATGCTGAGG + Intronic
1062212654 9:135373067-135373089 GGGCCCTGGGGCCTATGCAGGGG - Intergenic
1062449389 9:136609200-136609222 GGGGTCTGGGCCATATTCCAGGG - Intergenic
1062708412 9:137957859-137957881 GGGCCCTTAGCCATATCCCAAGG + Intronic
1185729039 X:2446327-2446349 GGTCCCTTGGCCACATGCTTAGG - Intronic
1185731456 X:2465053-2465075 GGTCCCTTGGCCATATGCCTAGG - Intronic
1185732129 X:2469727-2469749 GGTCCCTTGGCTATATGCTTAGG - Intronic
1185732723 X:2474251-2474273 GGTCCCTTGGCCACATGCTTTGG - Intronic
1185733371 X:2478790-2478812 GGTCCCCGGGCCACATTCTAAGG - Intronic
1187431324 X:19228000-19228022 GGTGACTGGGCCATATGCCAGGG - Intergenic
1191612364 X:63131362-63131384 GGACCCCTGGCCATATGCTTCGG + Intergenic
1191623933 X:63247564-63247586 GGACCCCTGGCCATATGCTTCGG - Intergenic
1192057577 X:67787850-67787872 AGGCCCTGTGCAAGATGCTAAGG + Intergenic
1192617411 X:72641979-72642001 AGGCACTGGGCTAGATGCTATGG - Intronic
1194434104 X:93848984-93849006 GGGCCCTGGACTATGTGCTCTGG + Intergenic
1195522650 X:105849396-105849418 GGGCCAGGGGCCGTATGATATGG - Intronic
1197266022 X:124372652-124372674 GGTCCATGGGCCATATGAAAAGG + Exonic
1197383083 X:125769561-125769583 GAGACCTGGGCAATTTGCTACGG - Intergenic