ID: 1160779716

View in Genome Browser
Species Human (GRCh38)
Location 19:872421-872443
Sequence CCGGGCCCGCAGCTGTAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 163}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160779716_1160779732 19 Left 1160779716 19:872421-872443 CCCTCCTACAGCTGCGGGCCCGG 0: 1
1: 0
2: 1
3: 8
4: 163
Right 1160779732 19:872463-872485 GGAGCTGAGAGGACCAGGGAAGG 0: 1
1: 0
2: 4
3: 89
4: 726
1160779716_1160779734 23 Left 1160779716 19:872421-872443 CCCTCCTACAGCTGCGGGCCCGG 0: 1
1: 0
2: 1
3: 8
4: 163
Right 1160779734 19:872467-872489 CTGAGAGGACCAGGGAAGGGAGG 0: 1
1: 0
2: 6
3: 62
4: 587
1160779716_1160779724 -3 Left 1160779716 19:872421-872443 CCCTCCTACAGCTGCGGGCCCGG 0: 1
1: 0
2: 1
3: 8
4: 163
Right 1160779724 19:872441-872463 CGGGCCCCTGGTGACTGTACTGG 0: 1
1: 0
2: 0
3: 9
4: 99
1160779716_1160779725 -2 Left 1160779716 19:872421-872443 CCCTCCTACAGCTGCGGGCCCGG 0: 1
1: 0
2: 1
3: 8
4: 163
Right 1160779725 19:872442-872464 GGGCCCCTGGTGACTGTACTGGG 0: 1
1: 0
2: 1
3: 15
4: 142
1160779716_1160779731 15 Left 1160779716 19:872421-872443 CCCTCCTACAGCTGCGGGCCCGG 0: 1
1: 0
2: 1
3: 8
4: 163
Right 1160779731 19:872459-872481 ACTGGGAGCTGAGAGGACCAGGG 0: 1
1: 0
2: 2
3: 38
4: 424
1160779716_1160779729 8 Left 1160779716 19:872421-872443 CCCTCCTACAGCTGCGGGCCCGG 0: 1
1: 0
2: 1
3: 8
4: 163
Right 1160779729 19:872452-872474 TGACTGTACTGGGAGCTGAGAGG 0: 1
1: 0
2: 2
3: 22
4: 216
1160779716_1160779733 20 Left 1160779716 19:872421-872443 CCCTCCTACAGCTGCGGGCCCGG 0: 1
1: 0
2: 1
3: 8
4: 163
Right 1160779733 19:872464-872486 GAGCTGAGAGGACCAGGGAAGGG 0: 1
1: 1
2: 3
3: 65
4: 510
1160779716_1160779735 30 Left 1160779716 19:872421-872443 CCCTCCTACAGCTGCGGGCCCGG 0: 1
1: 0
2: 1
3: 8
4: 163
Right 1160779735 19:872474-872496 GACCAGGGAAGGGAGGCCCCAGG 0: 1
1: 1
2: 8
3: 67
4: 511
1160779716_1160779730 14 Left 1160779716 19:872421-872443 CCCTCCTACAGCTGCGGGCCCGG 0: 1
1: 0
2: 1
3: 8
4: 163
Right 1160779730 19:872458-872480 TACTGGGAGCTGAGAGGACCAGG 0: 1
1: 0
2: 3
3: 20
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160779716 Original CRISPR CCGGGCCCGCAGCTGTAGGA GGG (reversed) Intronic
900126760 1:1072195-1072217 CCGGGCCTGCAGCTGGCGGCTGG + Exonic
900226283 1:1534991-1535013 CCGGGCCAGCATCTGTTTGAAGG - Intergenic
900241378 1:1619029-1619051 CCAGGCAGGCAGCTGCAGGAAGG + Intronic
901462427 1:9399722-9399744 TCGGGCCTCCAGCTGCAGGATGG - Intergenic
903024558 1:20418149-20418171 CAGGTCCCGCAGCTGGTGGATGG + Intergenic
903072020 1:20731408-20731430 CCAGGTCCTCAGCTGTAGGGTGG + Intronic
903421034 1:23217741-23217763 TCCGGCCCCCACCTGTAGGAGGG + Intergenic
903834070 1:26191351-26191373 CAGGGCCAGCAGCAGTTGGAAGG - Exonic
904753216 1:32754013-32754035 CCGGGCCCGCAGCCCCGGGAGGG - Intronic
906306842 1:44724946-44724968 CCTGGCCACCAGCTGCAGGAGGG + Intronic
907316832 1:53577614-53577636 CCAGGGCCACAGCTGTAGCAGGG - Intronic
908195517 1:61742808-61742830 CCGGGCCCGACGCAGGAGGACGG - Intronic
915325844 1:155080799-155080821 CTGGGCCGGCAGAGGTAGGAGGG + Intronic
918154580 1:181832555-181832577 CCGGGCCAGCAGCTGCAGAGGGG + Intergenic
918860205 1:189814652-189814674 ACAGGCCAGCAGCTGTGGGATGG - Intergenic
918942977 1:191026215-191026237 CCGGGCCAGCAGCTGCAGAGGGG - Intergenic
923523606 1:234755735-234755757 GCTGGCCAGCAGCTGTTGGAAGG - Intergenic
1062987810 10:1785644-1785666 TCGGGCCCTAAGCTGGAGGAGGG + Intergenic
1067362363 10:45594561-45594583 CCGGGCCCGCAGCGCAGGGATGG + Intronic
1073059483 10:100724735-100724757 CCAGGCCCGCAGCTGTAGGCCGG + Intergenic
1075866023 10:125719848-125719870 CCGGGGCCGCCGCTCGAGGAGGG + Exonic
1076737685 10:132466078-132466100 CCGGGCCCGCAGGTTGAGGCCGG + Intergenic
1077326420 11:1965914-1965936 CCCTGCCCGCGGGTGTAGGAGGG + Intronic
1078858589 11:15226708-15226730 CCATGCCAGCAGCTGCAGGAAGG + Intronic
1079107018 11:17578291-17578313 CAGGGGCAGCAGCTGGAGGATGG - Intronic
1079456753 11:20642985-20643007 CTGGACCCCAAGCTGTAGGAAGG - Intronic
1080456857 11:32426881-32426903 CCAGTCCCGCAGGTGGAGGAGGG - Intronic
1083879384 11:65540641-65540663 CCGGTCCCGCAGCTGCAGCCCGG + Intronic
1084295729 11:68212857-68212879 CCGGGCCCGCGGCCGCACGAGGG - Intronic
1084404393 11:68962704-68962726 CCTGGCCCGCAGCTGGAGAAGGG + Intergenic
1088843965 11:113649565-113649587 CCGGGCCAGCAGCTGTGGAGGGG - Intergenic
1090586186 11:128215493-128215515 CCGGGCCAGCAGCTGCAGAGGGG - Intergenic
1202809401 11_KI270721v1_random:21093-21115 CCCTGCCCGCGGGTGTAGGAGGG + Intergenic
1096024811 12:48351101-48351123 CCGCGCCCGCCGCTGTGGGGAGG + Intronic
1096122017 12:49094436-49094458 CCCGGCCCGCAGCTCTGGGCTGG + Exonic
1096225504 12:49864433-49864455 CCAGGCTGGCAGCTGTAGGCAGG - Intergenic
1096598706 12:52714492-52714514 CCGGGCCCGCGGCGGTAGCCGGG - Intergenic
1103623119 12:122200804-122200826 CCGGCCCAGCACCTGGAGGATGG - Exonic
1103898747 12:124292280-124292302 CCAGGCCCAGCGCTGTAGGAAGG - Intronic
1104736699 12:131139608-131139630 CCGGTCCCGCAGCACCAGGAGGG + Exonic
1105883485 13:24623496-24623518 CCGGGCCAGCAGCTGTGGAGGGG + Intergenic
1106221324 13:27748535-27748557 CCGGGCCAGCAGCTGTGGAGGGG - Intergenic
1107823591 13:44307733-44307755 CCGGGCCCAGTGCTCTAGGAGGG + Intergenic
1108541595 13:51452044-51452066 CCGGGCACGGAGCTGCGGGACGG + Exonic
1113910368 13:113838635-113838657 CCAGCCCCGCAGCAGGAGGAAGG + Intronic
1116296442 14:43118063-43118085 CCTGACCCACAGCTGTAGGTGGG - Intergenic
1116392717 14:44412988-44413010 TGGGGCCCACTGCTGTAGGATGG - Intergenic
1119618331 14:76112988-76113010 CCGGGCCTGGAGCTGGGGGAAGG + Intergenic
1120214673 14:81668932-81668954 CCGGGCCAGCAGCTGCAGAGGGG - Intergenic
1122816619 14:104317126-104317148 CAGGGGCCCCAGCTGCAGGATGG - Intergenic
1124426845 15:29570207-29570229 CCGAGCCCGCAGCGGCCGGAGGG - Intronic
1124629798 15:31329639-31329661 CCGGGCCTCCCGCTGTAGGTGGG + Intronic
1126150871 15:45522721-45522743 CCGCGCCCGCTGCTGGAGGCCGG + Exonic
1131656338 15:94462771-94462793 CAGGGTCCTCATCTGTAGGATGG + Intronic
1133032351 16:3017519-3017541 CCCGGCCGGCAGCGGTCGGAGGG + Intronic
1136037240 16:27549669-27549691 CCGGTCCTGGAGCTGTAGGTCGG + Exonic
1137023304 16:35451410-35451432 CTGGGCCTGCAGCTTTAGGCTGG - Intergenic
1141462635 16:84186829-84186851 GCGGACCCGCAGATGTAGGAGGG - Intronic
1141542560 16:84737197-84737219 CTGGGCCCGTGGCTATAGGAAGG - Intronic
1142591164 17:1006737-1006759 CCGGGCCCGTGGCTGGCGGAGGG - Intronic
1142591184 17:1006802-1006824 CCGGGCCCGTGGCTGGCGGAGGG - Intronic
1142591204 17:1006867-1006889 CCGGGCCCGTGGCTGGCGGAGGG - Intronic
1142591224 17:1006932-1006954 CCGGGCCCGTGGCTGGCGGAGGG - Intronic
1142591244 17:1006997-1007019 CCGGGCCCGTGGCTGGCGGAGGG - Intronic
1142591264 17:1007062-1007084 CCGGGCCCGTGGCTGGCGGAGGG - Intronic
1142591284 17:1007127-1007149 CCGGGCCCGTGGCTGGCGGAGGG - Intronic
1145747891 17:27333293-27333315 CCCGCCCCGCAGCTGGAGAAGGG + Intergenic
1150213346 17:63453602-63453624 CAGGGCCCACAGCTGTTGGAAGG + Intergenic
1151767358 17:76139313-76139335 CTGGGACAGCAGCTTTAGGAAGG + Intronic
1152649160 17:81483971-81483993 CCAGGCCAGCCGCTGCAGGAGGG + Intergenic
1152697849 17:81805414-81805436 CCCGGCAGGCAGCTGTGGGAGGG + Intronic
1152815266 17:82404180-82404202 GCGGGCCCGGAGCCGTACGAAGG - Intronic
1154991284 18:21600475-21600497 CTGGGACCGGAGCAGTAGGAAGG + Intronic
1158648814 18:59269122-59269144 CCGGGCCCGCACGGGTAGGAGGG + Exonic
1160479442 18:79225535-79225557 TTGGCCCCGCAGTTGTAGGACGG + Intronic
1160663404 19:311980-312002 GCGGGGCCGCAGCGGAAGGAAGG + Intronic
1160663423 19:312037-312059 GCGGGGCCGCAGCGGAAGGAAGG + Intronic
1160663443 19:312094-312116 GCGGGGCCGCAGCGGAAGGAAGG + Intronic
1160663462 19:312151-312173 GCGGGGCCGCAGCGGAAGGAAGG + Intronic
1160779716 19:872421-872443 CCGGGCCCGCAGCTGTAGGAGGG - Intronic
1161091041 19:2360201-2360223 CTGGGCCCGGGGCTGGAGGAAGG - Intergenic
1161415846 19:4145839-4145861 CCGACCCCGCATCTGTAGCAGGG + Intergenic
1162141200 19:8586459-8586481 CCGGGCCAGCACCTGGAGAAAGG + Exonic
1163636930 19:18441323-18441345 CTGGGCCTGCAGCTGTGGGGGGG - Intergenic
1164581972 19:29440159-29440181 CCGGGCCAGCAGCTGCAGAGGGG + Intergenic
1165718668 19:38063419-38063441 CCCGGCCCCCAGCGGCAGGATGG + Intronic
925556294 2:5134620-5134642 CAGGGCCCTCAGCAGGAGGAGGG + Intergenic
926581695 2:14636568-14636590 CTGGGGCCGCAGCTGGAGGGAGG - Exonic
937044726 2:118845203-118845225 CCCGGCCGGCAGCTGTGGGGCGG + Intronic
937608199 2:123826965-123826987 CCGGGCCAGCAGCTGTGGAGGGG - Intergenic
937611689 2:123869428-123869450 CCGAGCGCGCAGCTTTGGGAAGG + Intergenic
946938460 2:224746224-224746246 TCAGGCCTGGAGCTGTAGGATGG - Intergenic
947389904 2:229628242-229628264 CCAGGGCACCAGCTGTAGGAAGG + Intronic
947741438 2:232486743-232486765 CTGGGGCCGCAGCTGCGGGAAGG + Exonic
949027782 2:241774453-241774475 CCGGGTCCGGGGCTGCAGGAAGG - Intergenic
1168814611 20:728214-728236 CCGGGTCCGCAGCTGACGGTGGG + Intergenic
1170621373 20:17999194-17999216 CCTGGCCCTCAGCTGATGGACGG + Intronic
1171060775 20:21957082-21957104 CAGTGTCAGCAGCTGTAGGAAGG + Intergenic
1171179832 20:23084396-23084418 CAGGGCCAGCAGGAGTAGGATGG + Exonic
1174535637 20:51249155-51249177 CCGGTCCTGCAGCAGTGGGAAGG - Intergenic
1176159075 20:63639441-63639463 CAGGGCCCGCTGCTGTGGGTGGG - Intergenic
1179786621 21:43733937-43733959 CGGGGCCCCCAGCTGCAGGCTGG - Intronic
1180952804 22:19728354-19728376 CCAGGGCCGCTGCTGTGGGATGG - Intergenic
1183391371 22:37547157-37547179 CTGGGCCAGCAGCTGTGGGGTGG - Intergenic
1184562965 22:45274041-45274063 CCAGACCCTCAGCTGTAGAAAGG + Intergenic
1184865656 22:47200613-47200635 TCGGGCCAGCAGATGTGGGACGG + Intergenic
954304650 3:49719196-49719218 CAGGGCGCGCAGCTGGAAGAGGG + Exonic
959515886 3:107266687-107266709 CTGGGCCAGCAGCTGAATGATGG + Intergenic
961333496 3:126156597-126156619 CGGAGCCCACAGCTGCAGGAGGG - Intronic
961345022 3:126258694-126258716 CCAGGCCAGCACCTGTTGGAGGG + Intergenic
961407622 3:126692877-126692899 CAGGTGCCTCAGCTGTAGGATGG - Intergenic
962881740 3:139584308-139584330 CCGAGCACGCAGCTTTGGGAGGG + Intronic
964501721 3:157355278-157355300 CCAGGCACGCTGCTGTAGGCAGG - Intronic
968871079 4:3242854-3242876 CTGGGCCCGCAGCGGAAGGGAGG - Exonic
969333807 4:6495066-6495088 CAGGGCCCTCAGCTGTGGGATGG - Intronic
979536207 4:121823488-121823510 CCGGGTCCGCGGTTGTTGGACGG + Exonic
981938592 4:150258388-150258410 CTAGGCCCACAGCTGTAGCAGGG + Intergenic
982358095 4:154491063-154491085 CCGGCCGCGCAGCAGCAGGAGGG - Intronic
983843178 4:172482092-172482114 CCGGGCCAGCAGCTGTGGAGGGG - Intronic
984805342 4:183746661-183746683 CCGGGCCAGCAGCTGCAGAGGGG - Intergenic
989956850 5:50369579-50369601 CCGGGCCAGCGGCTGTAGAGGGG + Intergenic
992341826 5:75832182-75832204 CAAGGCCCGCAGATGTGGGATGG + Intergenic
993885717 5:93412725-93412747 CCAGGCCCCCAGCTGTAGGCTGG + Intergenic
996862452 5:128082883-128082905 CCGGGCCTGAACCTGGAGGAGGG - Intergenic
997474324 5:134133897-134133919 CCAGGCCAGCAGCTGTAGACTGG + Intronic
998095694 5:139394554-139394576 ACGGGGCCGCAGCTCTAGGTAGG + Exonic
998139267 5:139690657-139690679 CCGGGCCCCCACCTCGAGGAGGG + Intergenic
998161100 5:139813482-139813504 ACGGGCCCGCTGCTGGATGAGGG - Exonic
999271086 5:150296759-150296781 CCTGGCCCCCAGCTGAAGCATGG - Exonic
999449462 5:151667382-151667404 CTGGGCCCCCAGCTGCAGGGCGG - Intronic
999650001 5:153756100-153756122 CTGGGCCTGCAGCTGTTGGGGGG - Intronic
1001404000 5:171462794-171462816 CGGGGCCTGCAGCTGCAGGGCGG - Intergenic
1001939944 5:175733233-175733255 CCCGGCTCGCAGCTGTCGGCTGG - Intergenic
1002796487 6:475054-475076 CCGGTACCTCAGCTGGAGGATGG - Intergenic
1006351099 6:33521727-33521749 CCGGGCCAGCAGCTGTGGAGGGG - Intergenic
1007367692 6:41406428-41406450 GCGGGCACGCGGCTGGAGGAGGG + Intergenic
1014586299 6:123202092-123202114 CTGGGCCAGCAGCTGCAGAAGGG + Intergenic
1017929403 6:158939163-158939185 CCGGGGCCGCAGGTCTAGGAGGG - Intergenic
1018083126 6:160276042-160276064 CCGGGCCCTCAGCTGGACGCTGG - Intronic
1018638346 6:165884404-165884426 CCTGGACAGCAGCTGGAGGAAGG + Intronic
1019529079 7:1494736-1494758 CCGGGCCGGCTGCGGCAGGAAGG - Intronic
1019576919 7:1742105-1742127 CTGGGCCCGCAGCTGAGGGCTGG - Intronic
1022156095 7:27663030-27663052 CCAGGTCCGCAGCTGTGCGAAGG + Intergenic
1024561392 7:50648273-50648295 CCGGGCCTGCAGCAGCATGAGGG - Intronic
1031162484 7:118184416-118184438 CTGGGCCCGCAGCAGCGGGAAGG - Intronic
1031986410 7:128167121-128167143 TCGGGCCCGCAGGTGTGGGTGGG + Intergenic
1034275693 7:149822903-149822925 GCGGGCCGGCAGCTGCAGGGTGG - Intergenic
1037988504 8:23304383-23304405 CCAGGCCCGGGGCTGAAGGAAGG + Intronic
1041373905 8:57193274-57193296 TCAGCCCAGCAGCTGTAGGAGGG + Intergenic
1041384061 8:57280036-57280058 CCGGCCCTTCAGCTGCAGGAGGG + Intergenic
1045096217 8:98800728-98800750 CCGGGCCAGCAGCTGCGGAAGGG + Intronic
1045547277 8:103140543-103140565 GCGGCCCCGCAGCCGGAGGAGGG - Intronic
1046330784 8:112712496-112712518 GAGGCCCCGCAACTGTAGGATGG + Intronic
1046521393 8:115330788-115330810 CCGGGCCAGCAGCTGCAGAGGGG - Intergenic
1046932491 8:119855620-119855642 CTGTGCCAGCAGCTGGAGGATGG - Exonic
1049352413 8:142171311-142171333 CAGGGGCTGCAGCTGCAGGAGGG - Intergenic
1049612546 8:143562197-143562219 CCGTGCCCACAGCTGGAGCAGGG + Exonic
1049651406 8:143771527-143771549 CCTGGCCCGGAGCTGCCGGAAGG - Intergenic
1049654357 8:143791290-143791312 CCAGGCCCGCAGGAGGAGGATGG - Exonic
1049746588 8:144265716-144265738 CCGGGCCCCCTGCTGCAGGAGGG + Intronic
1049782562 8:144435597-144435619 CCGGGCAGGCAGGTGTAGGGTGG - Intronic
1050294913 9:4195438-4195460 CCGGGCCAGCAGCTGCAGAGGGG + Intronic
1055641043 9:78319345-78319367 CTGGGCTTGCAGCTGGAGGAGGG - Intronic
1057139077 9:92716017-92716039 CCGGGTGCGGAGCTGTGGGAGGG + Intronic
1057906218 9:98985657-98985679 CCAGGCCCGAAACTGTAGGCCGG - Exonic
1059745577 9:117197234-117197256 CCGAGCACGCAGCTTCAGGAGGG - Intronic
1061666741 9:132164391-132164413 CGGGTCCTGCAGCTGAAGGAAGG + Intronic
1062005457 9:134236479-134236501 CTGGGGCCTCAGCTGGAGGAGGG + Intergenic
1062414116 9:136439361-136439383 CCGGCCCCGCAGCCGCCGGAAGG - Exonic
1062671126 9:137709991-137710013 CCCGGCCCCCAGCTGTGGGTGGG + Intronic
1194204465 X:90995546-90995568 CCGGGCCAGCAGCTGTGGAGGGG + Intergenic
1194340454 X:92699701-92699723 CCGGGCCAGCAGCTGTGGAGGGG - Intergenic
1200648813 Y:5816437-5816459 CCGGGCCAGCAGCTGTGGAGGGG - Intergenic